\
| Variant ID: vg0715496749 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15496749 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGATGAGAGGTAATACCCTACTCCTGTTTGGGGATTTAAATCCACCGGGTGTAGTATAGATCTGACGATCATATGTGCTCATGCCCCTAGAGGGCCTCCT[G/A]
CCCACCTTATATAGGATGGGGGGCAGGATTACAAGATAGAAACCTTAACCAATATAGTATCGGTTTCCTAAATTTATTTTACAATATTATCAAATCAGGA
TCCTGATTTGATAATATTGTAAAATAAATTTAGGAAACCGATACTATATTGGTTAAGGTTTCTATCTTGTAATCCTGCCCCCCATCCTATATAAGGTGGG[C/T]
AGGAGGCCCTCTAGGGGCATGAGCACATATGATCGTCAGATCTATACTACACCCGGTGGATTTAAATCCCCAAACAGGAGTAGGGTATTACCTCTCATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.60% | 0.30% | 12.02% | 56.16% | NA |
| All Indica | 2759 | 22.00% | 0.10% | 14.14% | 63.75% | NA |
| All Japonica | 1512 | 54.20% | 0.40% | 6.22% | 39.15% | NA |
| Aus | 269 | 13.40% | 0.00% | 13.01% | 73.61% | NA |
| Indica I | 595 | 40.50% | 0.00% | 9.92% | 49.58% | NA |
| Indica II | 465 | 21.70% | 0.60% | 11.40% | 66.24% | NA |
| Indica III | 913 | 5.30% | 0.00% | 16.43% | 78.31% | NA |
| Indica Intermediate | 786 | 27.50% | 0.10% | 16.28% | 56.11% | NA |
| Temperate Japonica | 767 | 75.60% | 0.00% | 1.04% | 23.34% | NA |
| Tropical Japonica | 504 | 30.60% | 1.00% | 12.10% | 56.35% | NA |
| Japonica Intermediate | 241 | 35.70% | 0.40% | 10.37% | 53.53% | NA |
| VI/Aromatic | 96 | 4.20% | 0.00% | 33.33% | 62.50% | NA |
| Intermediate | 90 | 28.90% | 2.20% | 18.89% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715496749 | G -> DEL | N | N | silent_mutation | Average:23.443; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0715496749 | G -> A | LOC_Os07g26810.1 | upstream_gene_variant ; 709.0bp to feature; MODIFIER | silent_mutation | Average:23.443; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0715496749 | G -> A | LOC_Os07g26810-LOC_Os07g26820 | intergenic_region ; MODIFIER | silent_mutation | Average:23.443; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715496749 | 2.03E-06 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715496749 | 2.69E-06 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715496749 | 1.49E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715496749 | 8.70E-06 | NA | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715496749 | 4.04E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715496749 | 9.39E-06 | NA | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715496749 | 2.06E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |