Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715448699:

Variant ID: vg0715448699 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15448699
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

GCCACGTAGACGTAGACGCCACGTCAGCCAAAACCACCTTCAAAACCGCCGAGAGATCTCATTTGCACCGTTTTTGATAATTTAGGGACCGGTTATATCT[G/A]
GTTTTGGGGTTAAGGATGAAAATCGGATTTGGCGTAAAATTAAGGGACCTAAGATGAACTTATTCCTTCTTTTTTCTTCTCTCTTTCGAGCCAATCATTT

Reverse complement sequence

AAATGATTGGCTCGAAAGAGAGAAGAAAAAAGAAGGAATAAGTTCATCTTAGGTCCCTTAATTTTACGCCAAATCCGATTTTCATCCTTAACCCCAAAAC[C/T]
AGATATAACCGGTCCCTAAATTATCAAAAACGGTGCAAATGAGATCTCTCGGCGGTTTTGAAGGTGGTTTTGGCTGACGTGGCGTCTACGTCTACGTGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.40%	15.50%	31.06%	35.08%	NA
All Indica	2759	8.60%	24.50%	43.13%	23.74%	NA
All Japonica	1512	39.60%	0.90%	1.12%	58.40%	NA
Aus	269	1.90%	11.20%	73.61%	13.38%	NA
Indica I	595	15.60%	7.20%	45.38%	31.76%	NA
Indica II	465	6.20%	9.20%	44.52%	40.00%	NA
Indica III	913	2.10%	47.30%	42.61%	8.00%	NA
Indica Intermediate	786	12.30%	20.10%	41.22%	26.34%	NA
Temperate Japonica	767	69.90%	0.40%	0.65%	29.07%	NA
Tropical Japonica	504	2.20%	1.00%	1.59%	95.24%	NA
Japonica Intermediate	241	21.60%	2.10%	1.66%	74.69%	NA
VI/Aromatic	96	4.20%	5.20%	37.50%	53.12%	NA
Intermediate	90	24.40%	8.90%	30.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715448699	G -> DEL	N	N	silent_mutation	Average:69.928; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448699	G -> A	LOC_Os07g26730.1	upstream_gene_variant ; 1953.0bp to feature; MODIFIER	silent_mutation	Average:69.928; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448699	G -> A	LOC_Os07g26740.1	upstream_gene_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:69.928; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448699	G -> A	LOC_Os07g26750.1	downstream_gene_variant ; 3251.0bp to feature; MODIFIER	silent_mutation	Average:69.928; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448699	G -> A	LOC_Os07g26730-LOC_Os07g26740	intergenic_region ; MODIFIER	silent_mutation	Average:69.928; most accessible tissue: Callus, score: 98.813	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715448699	NA	6.56E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448699	3.73E-06	3.73E-06	mr1370	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448699	NA	7.54E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448699	NA	9.89E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448699	NA	3.90E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448699	NA	1.02E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448699	NA	7.32E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251