\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715414736:

Variant ID: vg0715414736 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15414736
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTAAATGTAGGCATTTTTCTATTTTTTTAAAAAAACAATATAGTTGAAAATGACATCAATCTTTTTTTTTGGAAGAGCAGAAATATGTTACTCAACC[A/T]
AGCGTCAGTATGGACTAACTGAGAGATAAAATTGCAAGTATCTCCTAACAAAAAATCAGAAACAAAATCTGAACGAGCCTTATTAGCTAGCACATGGCTT

Reverse complement sequence

AAGCCATGTGCTAGCTAATAAGGCTCGTTCAGATTTTGTTTCTGATTTTTTGTTAGGAGATACTTGCAATTTTATCTCTCAGTTAGTCCATACTGACGCT[T/A]
GGTTGAGTAACATATTTCTGCTCTTCCAAAAAAAAAGATTGATGTCATTTTCAACTATATTGTTTTTTTAAAAAAATAGAAAAATGCCTACATTTAGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 3.90% 29.71% 15.74% NA
All Indica  2759 25.80% 6.60% 42.81% 24.79% NA
All Japonica  1512 99.20% 0.00% 0.46% 0.33% NA
Aus  269 16.40% 0.00% 69.52% 14.13% NA
Indica I  595 32.30% 12.90% 30.42% 24.37% NA
Indica II  465 16.60% 0.90% 51.18% 31.40% NA
Indica III  913 20.40% 4.70% 49.84% 25.08% NA
Indica Intermediate  786 32.70% 7.40% 39.06% 20.87% NA
Temperate Japonica  767 99.10% 0.00% 0.52% 0.39% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.41% NA
VI/Aromatic  96 87.50% 0.00% 8.33% 4.17% NA
Intermediate  90 57.80% 4.40% 23.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715414736 A -> DEL N N silent_mutation Average:63.833; most accessible tissue: Callus, score: 77.436 N N N N
vg0715414736 A -> T LOC_Os07g26690.1 downstream_gene_variant ; 4935.0bp to feature; MODIFIER silent_mutation Average:63.833; most accessible tissue: Callus, score: 77.436 N N N N
vg0715414736 A -> T LOC_Os07g26690.2 downstream_gene_variant ; 4935.0bp to feature; MODIFIER silent_mutation Average:63.833; most accessible tissue: Callus, score: 77.436 N N N N
vg0715414736 A -> T LOC_Os07g26690-LOC_Os07g26700 intergenic_region ; MODIFIER silent_mutation Average:63.833; most accessible tissue: Callus, score: 77.436 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715414736 NA 2.09E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736 NA 2.81E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736 2.00E-06 1.99E-06 mr1151 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736 NA 4.33E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736 NA 2.78E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736 NA 1.20E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251