\
| Variant ID: vg0715414736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15414736 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 123. )
AAACTAAATGTAGGCATTTTTCTATTTTTTTAAAAAAACAATATAGTTGAAAATGACATCAATCTTTTTTTTTGGAAGAGCAGAAATATGTTACTCAACC[A/T]
AGCGTCAGTATGGACTAACTGAGAGATAAAATTGCAAGTATCTCCTAACAAAAAATCAGAAACAAAATCTGAACGAGCCTTATTAGCTAGCACATGGCTT
AAGCCATGTGCTAGCTAATAAGGCTCGTTCAGATTTTGTTTCTGATTTTTTGTTAGGAGATACTTGCAATTTTATCTCTCAGTTAGTCCATACTGACGCT[T/A]
GGTTGAGTAACATATTTCTGCTCTTCCAAAAAAAAAGATTGATGTCATTTTCAACTATATTGTTTTTTTAAAAAAATAGAAAAATGCCTACATTTAGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 3.90% | 29.71% | 15.74% | NA |
| All Indica | 2759 | 25.80% | 6.60% | 42.81% | 24.79% | NA |
| All Japonica | 1512 | 99.20% | 0.00% | 0.46% | 0.33% | NA |
| Aus | 269 | 16.40% | 0.00% | 69.52% | 14.13% | NA |
| Indica I | 595 | 32.30% | 12.90% | 30.42% | 24.37% | NA |
| Indica II | 465 | 16.60% | 0.90% | 51.18% | 31.40% | NA |
| Indica III | 913 | 20.40% | 4.70% | 49.84% | 25.08% | NA |
| Indica Intermediate | 786 | 32.70% | 7.40% | 39.06% | 20.87% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.52% | 0.39% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 8.33% | 4.17% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 23.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715414736 | A -> DEL | N | N | silent_mutation | Average:63.833; most accessible tissue: Callus, score: 77.436 | N | N | N | N |
| vg0715414736 | A -> T | LOC_Os07g26690.1 | downstream_gene_variant ; 4935.0bp to feature; MODIFIER | silent_mutation | Average:63.833; most accessible tissue: Callus, score: 77.436 | N | N | N | N |
| vg0715414736 | A -> T | LOC_Os07g26690.2 | downstream_gene_variant ; 4935.0bp to feature; MODIFIER | silent_mutation | Average:63.833; most accessible tissue: Callus, score: 77.436 | N | N | N | N |
| vg0715414736 | A -> T | LOC_Os07g26690-LOC_Os07g26700 | intergenic_region ; MODIFIER | silent_mutation | Average:63.833; most accessible tissue: Callus, score: 77.436 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715414736 | NA | 2.09E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715414736 | NA | 2.81E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715414736 | 2.00E-06 | 1.99E-06 | mr1151 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715414736 | NA | 4.33E-07 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715414736 | NA | 2.78E-06 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715414736 | NA | 1.20E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |