\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715411335:

Variant ID: vg0715411335 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15411335
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGACACGAAAACTCATAGTTGCACTTAAAATAAGATAGATGGAGTACTCTATTCGTCTTAAAATAAGTGCAACCCTATAAACTACACTTATTTTGAAAC[G/A]
AATAAAATATAGGAGTATAATCATCTATTATATAGTAAAAGTCCATTAAACTTCCAAGAAACGCTCTTAAGCCGCCACGTGACGTTCCTACAAATACTAC

Reverse complement sequence

GTAGTATTTGTAGGAACGTCACGTGGCGGCTTAAGAGCGTTTCTTGGAAGTTTAATGGACTTTTACTATATAATAGATGATTATACTCCTATATTTTATT[C/T]
GTTTCAAAATAAGTGTAGTTTATAGGGTTGCACTTATTTTAAGACGAATAGAGTACTCCATCTATCTTATTTTAAGTGCAACTATGAGTTTTCGTGTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.90% 0.04% 0.00% NA
All Indica  2759 39.30% 60.60% 0.07% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 75.10% 24.90% 0.00% 0.00% NA
Indica I  595 49.40% 50.60% 0.00% 0.00% NA
Indica II  465 14.60% 85.40% 0.00% 0.00% NA
Indica III  913 35.50% 64.40% 0.11% 0.00% NA
Indica Intermediate  786 50.80% 49.10% 0.13% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715411335 G -> A LOC_Os07g26690.1 downstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:53.48; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0715411335 G -> A LOC_Os07g26690.2 downstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:53.48; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0715411335 G -> A LOC_Os07g26690-LOC_Os07g26700 intergenic_region ; MODIFIER silent_mutation Average:53.48; most accessible tissue: Minghui63 flower, score: 76.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715411335 3.73E-06 NA mr1645 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715411335 7.65E-06 NA mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715411335 NA 7.35E-06 mr1647 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715411335 NA 4.51E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251