\
| Variant ID: vg0715411335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15411335 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGACACGAAAACTCATAGTTGCACTTAAAATAAGATAGATGGAGTACTCTATTCGTCTTAAAATAAGTGCAACCCTATAAACTACACTTATTTTGAAAC[G/A]
AATAAAATATAGGAGTATAATCATCTATTATATAGTAAAAGTCCATTAAACTTCCAAGAAACGCTCTTAAGCCGCCACGTGACGTTCCTACAAATACTAC
GTAGTATTTGTAGGAACGTCACGTGGCGGCTTAAGAGCGTTTCTTGGAAGTTTAATGGACTTTTACTATATAATAGATGATTATACTCCTATATTTTATT[C/T]
GTTTCAAAATAAGTGTAGTTTATAGGGTTGCACTTATTTTAAGACGAATAGAGTACTCCATCTATCTTATTTTAAGTGCAACTATGAGTTTTCGTGTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 37.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 39.30% | 60.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 35.50% | 64.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 50.80% | 49.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715411335 | G -> A | LOC_Os07g26690.1 | downstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:53.48; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0715411335 | G -> A | LOC_Os07g26690.2 | downstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:53.48; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0715411335 | G -> A | LOC_Os07g26690-LOC_Os07g26700 | intergenic_region ; MODIFIER | silent_mutation | Average:53.48; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715411335 | 3.73E-06 | NA | mr1645 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715411335 | 7.65E-06 | NA | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715411335 | NA | 7.35E-06 | mr1647 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715411335 | NA | 4.51E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |