\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715405360:

Variant ID: vg0715405360 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15405360
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCTGCCAAAAACAGATGTGTAAAAACATTTTTCATTTATTAGATTATTTGTGGAGGAATTTGTAGTATTAAAATCTGATAGGAGTTTTTTTTCGTTT[T/C]
GTGAAATAGAGGATTGAAGCTTTCTAAATCATATAAAATTCCTTAGAAATAGCTCAATACATGTAGATTTGGAAGGGAAGTTAACAAGAGTTCTAATATC

Reverse complement sequence

GATATTAGAACTCTTGTTAACTTCCCTTCCAAATCTACATGTATTGAGCTATTTCTAAGGAATTTTATATGATTTAGAAAGCTTCAATCCTCTATTTCAC[A/G]
AAACGAAAAAAAACTCCTATCAGATTTTAATACTACAAATTCCTCCACAAATAATCTAATAAATGAAAAATGTTTTTACACATCTGTTTTTGGCAGCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.50% 0.08% 0.00% NA
All Indica  2759 75.50% 24.30% 0.14% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 83.70% 16.00% 0.34% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 68.30% 31.70% 0.00% 0.00% NA
Indica Intermediate  786 67.30% 32.40% 0.25% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715405360 T -> C LOC_Os07g26690.1 upstream_gene_variant ; 1082.0bp to feature; MODIFIER silent_mutation Average:31.99; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg0715405360 T -> C LOC_Os07g26690.2 upstream_gene_variant ; 1082.0bp to feature; MODIFIER silent_mutation Average:31.99; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg0715405360 T -> C LOC_Os07g26670-LOC_Os07g26690 intergenic_region ; MODIFIER silent_mutation Average:31.99; most accessible tissue: Minghui63 root, score: 47.894 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715405360 NA 6.01E-09 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 2.29E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.79E-10 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 7.19E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.75E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.00E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 6.60E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 8.25E-08 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 3.53E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.00E-10 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 9.64E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 9.65E-06 9.80E-12 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 4.73E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 5.12E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 3.71E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 3.30E-10 mr1950 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 7.23E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.02E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 7.59E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 3.97E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.28E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 2.51E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 5.78E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 4.38E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 1.42E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715405360 NA 3.50E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251