Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715404922:

Variant ID: vg0715404922 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15404922
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAAAACTAGAAACTGAGAATAATTGGAAGAATATGTAGGATACTTAAGGCCCAATATCCTCTTCCTTTTTCAATTTGTAAACCATTTTTGGTTTTGC[A/C]
CTCAAATTTGAATTTAGCTTACTCTATTTCAAAAAAATTCTTCACCATTGGCAATTACAAATCAACAACTACATCCATGAATATTTTCAGTTTTTTTCGA

Reverse complement sequence

TCGAAAAAAACTGAAAATATTCATGGATGTAGTTGTTGATTTGTAATTGCCAATGGTGAAGAATTTTTTTGAAATAGAGTAAGCTAAATTCAAATTTGAG[T/G]
GCAAAACCAAAAATGGTTTACAAATTGAAAAAGGAAGAGGATATTGGGCCTTAAGTATCCTACATATTCTTCCAATTATTCTCAGTTTCTAGTTTTCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.80% 0.11% 0.00% NA
All Indica  2759 94.70% 5.10% 0.14% 0.00% NA
All Japonica  1512 1.10% 98.90% 0.00% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 98.50% 1.00% 0.50% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 86.80% 13.10% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715404922 A -> C LOC_Os07g26690.1 upstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:39.999; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0715404922 A -> C LOC_Os07g26690.2 upstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:39.999; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0715404922 A -> C LOC_Os07g26670-LOC_Os07g26690 intergenic_region ; MODIFIER silent_mutation Average:39.999; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715404922 NA 1.85E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 4.18E-32 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 3.71E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 3.01E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 5.82E-57 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 2.48E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 7.85E-24 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 8.28E-31 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.62E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 7.19E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 4.78E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 3.82E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.33E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 6.14E-06 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 6.29E-27 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.75E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 4.66E-20 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 4.26E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.28E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 2.44E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 3.41E-08 2.93E-77 mr1629 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.21E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 9.85E-56 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 3.15E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 4.69E-55 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 9.42E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.94E-41 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.33E-42 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 8.60E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.99E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 1.79E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 2.94E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 6.66E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715404922 NA 4.18E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251