Search for Variation information by Variation ID:
Detailed information for vg0715369506:
| Variant ID: vg0715369506 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15369506 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CGTCCTCGTCTACTGCACCGCCGGCGTCTCCGGCGGGCACATCAACCCGGCGGTGACGCTCGGCCTCTTCCTGGCCCGGAAGGTGTCCCTGGTGCGCGCC[C/G]
TCCTGTACATGGCGGCGCAGTGCCTCGGCGCCATCTGCGGCGTCGCGCTCGTCAAGGGGTTCCAGAGCGGCCTCTACGCGCGGCACGGCGGCGGCGCCAA
Reverse complement sequence
TTGGCGCCGCCGCCGTGCCGCGCGTAGAGGCCGCTCTGGAACCCCTTGACGAGCGCGACGCCGCAGATGGCGCCGAGGCACTGCGCCGCCATGTACAGGA[G/C]
GGCGCGCACCAGGGACACCTTCCGGGCCAGGAAGAGGCCGAGCGTCACCGCCGGGTTGATGTGCCCGCCGGAGACGCCGGCGGTGCAGTAGACGAGGACG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.60% | 22.90% | 0.15% | 0.40% | NA |
| All Indica | 2759 | 95.00% | 4.50% | 0.11% | 0.47% | NA |
| All Japonica | 1512 | 44.20% | 55.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.10% | 0.37% | 0.37% | NA |
| Indica I | 595 | 98.30% | 1.00% | 0.00% | 0.67% | NA |
| Indica II | 465 | 95.70% | 3.20% | 0.00% | 1.08% | NA |
| Indica III | 913 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 11.80% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 11.60% | 88.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 81.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 73.30% | 21.10% | 2.22% | 3.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715369506 | C -> DEL | LOC_Os07g26640.1 | N | frameshift_variant | Average:74.672; most accessible tissue: Minghui63 panicle, score: 89.444 | N | N | N | N |
| vg0715369506 | C -> G | LOC_Os07g26640.1 | missense_variant ; p.Leu65Val; MODERATE | nonsynonymous_codon ; L65V | Average:74.672; most accessible tissue: Minghui63 panicle, score: 89.444 | benign  |
0.086 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715369506 | NA | 2.04E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715369506 | 4.14E-06 | 4.14E-06 | mr1369_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715369506 | 5.45E-06 | 5.45E-06 | mr1453_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715369506 | NA | 3.94E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715369506 | 4.40E-06 | 4.40E-06 | mr1738_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |