Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715368259:

Variant ID: vg0715368259 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15368259
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATAGAGCAAAAAAGGCAAAGAAAAATAATGAGTATATGCGTATGGGATTGGGCTGCAACATGCGCGTGCACCACGTAACGTTAAGATGCCAAGCGCC[G/A]
TCCTCATTTGATCGTACAAAAACATCATATACGTAGCATTTTCCATTTCATAACAGTCTCATTCATTAATAGGGATTCCCATGTGTTTCAAGATAACCCC

Reverse complement sequence

GGGGTTATCTTGAAACACATGGGAATCCCTATTAATGAATGAGACTGTTATGAAATGGAAAATGCTACGTATATGATGTTTTTGTACGATCAAATGAGGA[C/T]
GGCGCTTGGCATCTTAACGTTACGTGGTGCACGCGCATGTTGCAGCCCAATCCCATACGCATATACTCATTATTTTTCTTTGCCTTTTTTGCTCTATCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	23.20%	0.28%	0.21%	NA
All Indica	2759	94.60%	4.80%	0.33%	0.25%	NA
All Japonica	1512	44.20%	55.80%	0.00%	0.00%	NA
Aus	269	90.70%	8.90%	0.37%	0.00%	NA
Indica I	595	98.00%	1.00%	0.34%	0.67%	NA
Indica II	465	95.70%	3.40%	0.65%	0.22%	NA
Indica III	913	98.80%	1.00%	0.22%	0.00%	NA
Indica Intermediate	786	86.60%	12.80%	0.25%	0.25%	NA
Temperate Japonica	767	11.60%	88.40%	0.00%	0.00%	NA
Tropical Japonica	504	80.20%	19.80%	0.00%	0.00%	NA
Japonica Intermediate	241	72.60%	27.40%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	81.20%	1.04%	1.04%	NA
Intermediate	90	73.30%	22.20%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715368259	G -> DEL	N	N	silent_mutation	Average:54.896; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0715368259	G -> A	LOC_Os07g26640.1	upstream_gene_variant ; 876.0bp to feature; MODIFIER	silent_mutation	Average:54.896; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0715368259	G -> A	LOC_Os07g26630-LOC_Os07g26640	intergenic_region ; MODIFIER	silent_mutation	Average:54.896; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715368259	NA	2.01E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715368259	NA	6.44E-06	mr1768	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715368259	NA	1.18E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715368259	7.72E-06	6.98E-07	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715368259	NA	9.86E-07	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715368259	NA	1.18E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715368259	NA	5.50E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251