\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715323407:

Variant ID: vg0715323407 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15323407
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGCTATCACGGCCGTTGACTTAAGGGATTTTTAACTATTTGCCACTCTCCTGGATAGCCATTCTCTTCTAGCTCTTCCTAATCTTTTGCCACTATAGC[G/A]
ATGTGAAATGTCCCTTTTGCCCCATTCCCTTTTCATCTCTCTTCTCCCTCCCTCCAGGCGGCGAGACGAGATGGGTCACGACGGAGCTCAGGGCCAACGG

Reverse complement sequence

CCGTTGGCCCTGAGCTCCGTCGTGACCCATCTCGTCTCGCCGCCTGGAGGGAGGGAGAAGAGAGATGAAAAGGGAATGGGGCAAAAGGGACATTTCACAT[C/T]
GCTATAGTGGCAAAAGATTAGGAAGAGCTAGAAGAGAATGGCTATCCAGGAGAGTGGCAAATAGTTAAAAATCCCTTAAGTCAACGGCCGTGATAGCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 15.10% 9.06% 37.07% NA
All Indica  2759 6.50% 22.60% 14.46% 56.43% NA
All Japonica  1512 99.10% 0.10% 0.20% 0.66% NA
Aus  269 8.60% 26.40% 7.06% 57.99% NA
Indica I  595 3.20% 11.30% 21.01% 64.54% NA
Indica II  465 5.20% 20.60% 17.42% 56.77% NA
Indica III  913 1.50% 33.50% 11.17% 53.78% NA
Indica Intermediate  786 15.50% 19.70% 11.58% 53.18% NA
Temperate Japonica  767 99.00% 0.00% 0.39% 0.65% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 87.50% 5.20% 0.00% 7.29% NA
Intermediate  90 52.20% 15.60% 7.78% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715323407 G -> DEL N N silent_mutation Average:71.043; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0715323407 G -> A LOC_Os07g26600.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:71.043; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0715323407 G -> A LOC_Os07g26600-LOC_Os07g26610 intergenic_region ; MODIFIER silent_mutation Average:71.043; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715323407 NA 2.92E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 2.51E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 1.22E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 6.82E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 4.40E-06 9.00E-09 mr1457 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 1.89E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 2.50E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 6.98E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 3.72E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 9.32E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 1.42E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 1.50E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 1.60E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 3.79E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 3.54E-06 4.27E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 2.45E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 5.20E-28 mr1888 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 7.11E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 2.04E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 8.05E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 3.75E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 4.39E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 8.62E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715323407 NA 1.26E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251