\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715317227:

Variant ID: vg0715317227 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15317227
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATCTTTTTTCTCTGTACTCTATAAAGCTTGTTGTAATTGCATCAGTTTCTCCAATAGAAATGCGAGGGGGCAGCCTCTCTAGTTAAAAGAAATATAA[G/A]
ATCTCTCAATATCCTCTGCTAGTGAGAAGATGTCATGTCTTCCCTTGGGTGAGGACAACATTAGCTTGGATATATCTATGGCTACCTTATATATGCATTA

Reverse complement sequence

TAATGCATATATAAGGTAGCCATAGATATATCCAAGCTAATGTTGTCCTCACCCAAGGGAAGACATGACATCTTCTCACTAGCAGAGGATATTGAGAGAT[C/T]
TTATATTTCTTTTAACTAGAGAGGCTGCCCCCTCGCATTTCTATTGGAGAAACTGATGCAATTACAACAAGCTTTATAGAGTACAGAGAAAAAAGATTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 37.00% 0.08% 4.51% NA
All Indica  2759 89.50% 4.10% 0.07% 6.31% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 79.90% 6.30% 0.74% 13.01% NA
Indica I  595 93.90% 1.80% 0.00% 4.20% NA
Indica II  465 95.30% 4.10% 0.00% 0.65% NA
Indica III  913 89.40% 1.40% 0.11% 9.09% NA
Indica Intermediate  786 83.00% 8.90% 0.13% 8.02% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 45.60% 50.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715317227 G -> DEL N N silent_mutation Average:50.249; most accessible tissue: Callus, score: 78.846 N N N N
vg0715317227 G -> A LOC_Os07g26595.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:50.249; most accessible tissue: Callus, score: 78.846 N N N N
vg0715317227 G -> A LOC_Os07g26600.1 downstream_gene_variant ; 4328.0bp to feature; MODIFIER silent_mutation Average:50.249; most accessible tissue: Callus, score: 78.846 N N N N
vg0715317227 G -> A LOC_Os07g26595-LOC_Os07g26600 intergenic_region ; MODIFIER silent_mutation Average:50.249; most accessible tissue: Callus, score: 78.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715317227 1.88E-06 NA mr1042 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 3.27E-06 NA mr1043 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 2.86E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 1.07E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 6.61E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 3.16E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 2.36E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 2.55E-60 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 1.13E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 7.72E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 7.37E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 5.88E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 1.34E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 6.22E-42 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 2.43E-06 NA mr1912 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 5.54E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 2.77E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 2.25E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 4.05E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 1.01E-17 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 1.70E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715317227 NA 4.45E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251