\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715311451:

Variant ID: vg0715311451 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15311451
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGAAAATCATTACGTGCCATCAACAAAGTCCACATTATCTACTCTAGGGAACTCTCTCGTTCTGCTCTATGCACCACGTTCGGATTGCTTGTTTTCTT[C/T]
CCTTTACACCATTTGCCTTTATAGCAGTGACCTAAGTAGTAGTACCACAGGATCCTAAGTTTAAATCTTTAAAGAAGTGAATTTTAGATTTGGTTATTTG

Reverse complement sequence

CAAATAACCAAATCTAAAATTCACTTCTTTAAAGATTTAAACTTAGGATCCTGTGGTACTACTACTTAGGTCACTGCTATAAAGGCAAATGGTGTAAAGG[G/A]
AAGAAAACAAGCAATCCGAACGTGGTGCATAGAGCAGAACGAGAGAGTTCCCTAGAGTAGATAATGTGGACTTTGTTGATGGCACGTAATGATTTTCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 0.30% 5.29% 3.55% NA
All Indica  2759 90.90% 0.50% 7.10% 1.49% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 34.60% 0.00% 18.22% 47.21% NA
Indica I  595 91.10% 0.80% 8.07% 0.00% NA
Indica II  465 97.60% 0.90% 1.29% 0.22% NA
Indica III  913 90.40% 0.40% 7.23% 1.97% NA
Indica Intermediate  786 87.50% 0.00% 9.67% 2.80% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 0.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715311451 C -> DEL N N silent_mutation Average:54.271; most accessible tissue: Callus, score: 87.673 N N N N
vg0715311451 C -> T LOC_Os07g26590.1 downstream_gene_variant ; 2281.0bp to feature; MODIFIER silent_mutation Average:54.271; most accessible tissue: Callus, score: 87.673 N N N N
vg0715311451 C -> T LOC_Os07g26595.1 downstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:54.271; most accessible tissue: Callus, score: 87.673 N N N N
vg0715311451 C -> T LOC_Os07g26590-LOC_Os07g26595 intergenic_region ; MODIFIER silent_mutation Average:54.271; most accessible tissue: Callus, score: 87.673 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715311451 NA 2.08E-08 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 5.11E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 1.28E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 1.53E-21 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 7.78E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 6.76E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 3.46E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 1.17E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 4.60E-08 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 2.22E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 4.94E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 2.53E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 7.67E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 6.49E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 2.24E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 7.94E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 5.55E-06 5.55E-06 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 7.81E-07 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 2.81E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 2.97E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 4.41E-06 4.41E-06 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715311451 NA 1.24E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251