\
| Variant ID: vg0715290134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15290134 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCAATTTCCCCCCTAACTGTGCAATTAGTTTTTTAATTTATCTCTATTTAATACTTCATACATGTGTCTAAAGATTCGATGTGATGTTTTTTGGAAAAA[G/A,T]
TTTTTGGGAACTAAACAGGGCCTTAGATAAGTTAGAGTAAAAAAACCAAAGAACCTTAGAGGGCATTAGAGAAGAAAATGAAGTGCCAAATACACTGCGC
GCGCAGTGTATTTGGCACTTCATTTTCTTCTCTAATGCCCTCTAAGGTTCTTTGGTTTTTTTACTCTAACTTATCTAAGGCCCTGTTTAGTTCCCAAAAA[C/T,A]
TTTTTCCAAAAAACATCACATCGAATCTTTAGACACATGTATGAAGTATTAAATAGAGATAAATTAAAAAACTAATTGCACAGTTAGGGGGGAAATTGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.90% | 43.10% | 3.70% | 9.33% | T: 0.02% |
| All Indica | 2759 | 18.10% | 64.40% | 5.98% | 11.45% | T: 0.04% |
| All Japonica | 1512 | 93.50% | 0.70% | 0.40% | 5.36% | NA |
| Aus | 269 | 20.10% | 75.10% | 0.37% | 4.46% | NA |
| Indica I | 595 | 9.20% | 75.10% | 7.56% | 8.07% | NA |
| Indica II | 465 | 6.90% | 73.30% | 8.82% | 10.97% | NA |
| Indica III | 913 | 20.30% | 63.40% | 2.30% | 14.02% | NA |
| Indica Intermediate | 786 | 28.90% | 52.30% | 7.38% | 11.32% | T: 0.13% |
| Temperate Japonica | 767 | 88.10% | 0.90% | 0.65% | 10.30% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 56.20% | 12.50% | 1.04% | 30.21% | NA |
| Intermediate | 90 | 58.90% | 35.60% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715290134 | G -> DEL | N | N | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> A | LOC_Os07g26540.1 | upstream_gene_variant ; 3022.0bp to feature; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> A | LOC_Os07g26530.1 | downstream_gene_variant ; 4948.0bp to feature; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> A | LOC_Os07g26550.1 | downstream_gene_variant ; 4755.0bp to feature; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> A | LOC_Os07g26530-LOC_Os07g26540 | intergenic_region ; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> T | LOC_Os07g26540.1 | upstream_gene_variant ; 3022.0bp to feature; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> T | LOC_Os07g26530.1 | downstream_gene_variant ; 4948.0bp to feature; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> T | LOC_Os07g26550.1 | downstream_gene_variant ; 4755.0bp to feature; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| vg0715290134 | G -> T | LOC_Os07g26530-LOC_Os07g26540 | intergenic_region ; MODIFIER | silent_mutation | Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715290134 | NA | 1.14E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 3.88E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | 4.84E-06 | 4.41E-07 | mr1510 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 1.89E-24 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 2.02E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 3.32E-15 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 5.28E-12 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 1.81E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 4.77E-24 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 1.56E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 4.43E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715290134 | NA | 2.55E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |