\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715290134:

Variant ID: vg0715290134 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15290134
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCAATTTCCCCCCTAACTGTGCAATTAGTTTTTTAATTTATCTCTATTTAATACTTCATACATGTGTCTAAAGATTCGATGTGATGTTTTTTGGAAAAA[G/A,T]
TTTTTGGGAACTAAACAGGGCCTTAGATAAGTTAGAGTAAAAAAACCAAAGAACCTTAGAGGGCATTAGAGAAGAAAATGAAGTGCCAAATACACTGCGC

Reverse complement sequence

GCGCAGTGTATTTGGCACTTCATTTTCTTCTCTAATGCCCTCTAAGGTTCTTTGGTTTTTTTACTCTAACTTATCTAAGGCCCTGTTTAGTTCCCAAAAA[C/T,A]
TTTTTCCAAAAAACATCACATCGAATCTTTAGACACATGTATGAAGTATTAAATAGAGATAAATTAAAAAACTAATTGCACAGTTAGGGGGGAAATTGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 43.10% 3.70% 9.33% T: 0.02%
All Indica  2759 18.10% 64.40% 5.98% 11.45% T: 0.04%
All Japonica  1512 93.50% 0.70% 0.40% 5.36% NA
Aus  269 20.10% 75.10% 0.37% 4.46% NA
Indica I  595 9.20% 75.10% 7.56% 8.07% NA
Indica II  465 6.90% 73.30% 8.82% 10.97% NA
Indica III  913 20.30% 63.40% 2.30% 14.02% NA
Indica Intermediate  786 28.90% 52.30% 7.38% 11.32% T: 0.13%
Temperate Japonica  767 88.10% 0.90% 0.65% 10.30% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 0.41% 0.83% NA
VI/Aromatic  96 56.20% 12.50% 1.04% 30.21% NA
Intermediate  90 58.90% 35.60% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715290134 G -> DEL N N silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> A LOC_Os07g26540.1 upstream_gene_variant ; 3022.0bp to feature; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> A LOC_Os07g26530.1 downstream_gene_variant ; 4948.0bp to feature; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> A LOC_Os07g26550.1 downstream_gene_variant ; 4755.0bp to feature; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> A LOC_Os07g26530-LOC_Os07g26540 intergenic_region ; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> T LOC_Os07g26540.1 upstream_gene_variant ; 3022.0bp to feature; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> T LOC_Os07g26530.1 downstream_gene_variant ; 4948.0bp to feature; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> T LOC_Os07g26550.1 downstream_gene_variant ; 4755.0bp to feature; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N
vg0715290134 G -> T LOC_Os07g26530-LOC_Os07g26540 intergenic_region ; MODIFIER silent_mutation Average:61.691; most accessible tissue: Zhenshan97 flower, score: 84.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715290134 NA 1.14E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 3.88E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 4.84E-06 4.41E-07 mr1510 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 1.89E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 2.02E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 3.32E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 5.28E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 1.81E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 4.77E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 1.56E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 4.43E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715290134 NA 2.55E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251