\
| Variant ID: vg0715275897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15275897 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAAGTTCCATTTACGTAATAAGGTTGATAATTTTAAGTAGGGTTTAGTTTTGGTGTATGATCCTGCACAAAATGAGTTTAAGGATCAATTCCTTGCTGAA[T/C]
TAGTTAATATGTGCAGTCATGAGACCTTACCAATTCTTATTGGTGGTGATTTTAATATTCTTCGTAGCCCTAATGAGAAAAATAATGATAATTTTGATGA
TCATCAAAATTATCATTATTTTTCTCATTAGGGCTACGAAGAATATTAAAATCACCACCAATAAGAATTGGTAAGGTCTCATGACTGCACATATTAACTA[A/G]
TTCAGCAAGGAATTGATCCTTAAACTCATTTTGTGCAGGATCATACACCAAAACTAAACCCTACTTAAAATTATCAACCTTATTACGTAAATGGAACTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 5.40% | 1.33% | 3.03% | NA |
| All Indica | 2759 | 98.30% | 0.20% | 0.29% | 1.27% | NA |
| All Japonica | 1512 | 78.60% | 13.50% | 3.04% | 4.89% | NA |
| Aus | 269 | 95.90% | 0.00% | 1.49% | 2.60% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 94.70% | 0.30% | 0.76% | 4.33% | NA |
| Temperate Japonica | 767 | 84.60% | 3.30% | 2.74% | 9.39% | NA |
| Tropical Japonica | 504 | 72.40% | 25.40% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 21.20% | 5.81% | 0.83% | NA |
| VI/Aromatic | 96 | 32.30% | 37.50% | 3.12% | 27.08% | NA |
| Intermediate | 90 | 83.30% | 13.30% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715275897 | T -> DEL | N | N | silent_mutation | Average:35.303; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0715275897 | T -> C | LOC_Os07g26510.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:35.303; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715275897 | 7.25E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 1.04E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 2.26E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 1.81E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 2.43E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 4.26E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 1.97E-08 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 5.60E-06 | 1.53E-07 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 1.91E-06 | mr1602 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 1.49E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 2.86E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 2.50E-06 | NA | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 8.53E-11 | NA | mr1104_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 4.00E-06 | 7.95E-08 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 1.45E-09 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 1.36E-06 | NA | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 2.67E-07 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 7.04E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | 6.30E-08 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 3.36E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 1.50E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715275897 | NA | 2.80E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |