\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715273808:

Variant ID: vg0715273808 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15273808
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGGCTTCACCCCTTCCTGTCAGATCTAGAAGGAGAGAGAGAGAGCGCATGATCTAGAGGGAGAAGAGAAGAAATAGAGGATGACACATTGGACCATT[C/A]
AGATTTTTTTTTGTTTGTTAACCTCATTACTATATTACCATGTCACTAAAATTAATGCCATGAGTCTGCGGCGTGTTTGCCACTTAGTATAAAAACCTCC

Reverse complement sequence

GGAGGTTTTTATACTAAGTGGCAAACACGCCGCAGACTCATGGCATTAATTTTAGTGACATGGTAATATAGTAATGAGGTTAACAAACAAAAAAAAATCT[G/T]
AATGGTCCAATGTGTCATCCTCTATTTCTTCTCTTCTCCCTCTAGATCATGCGCTCTCTCTCTCTCCTTCTAGATCTGACAGGAAGGGGTGAAGCCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 3.60% 0.95% 3.36% NA
All Indica  2759 97.90% 0.10% 0.36% 1.59% NA
All Japonica  1512 82.40% 10.50% 2.05% 5.03% NA
Aus  269 95.20% 0.00% 0.37% 4.46% NA
Indica I  595 99.00% 0.00% 0.84% 0.17% NA
Indica II  465 98.90% 0.40% 0.43% 0.22% NA
Indica III  913 99.70% 0.00% 0.11% 0.22% NA
Indica Intermediate  786 94.50% 0.10% 0.25% 5.09% NA
Temperate Japonica  767 86.00% 2.90% 1.43% 9.65% NA
Tropical Japonica  504 75.60% 22.40% 1.98% 0.00% NA
Japonica Intermediate  241 85.10% 10.00% 4.15% 0.83% NA
VI/Aromatic  96 70.80% 0.00% 1.04% 28.12% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715273808 C -> DEL N N silent_mutation Average:49.328; most accessible tissue: Callus, score: 90.642 N N N N
vg0715273808 C -> A LOC_Os07g26510.1 upstream_gene_variant ; 1402.0bp to feature; MODIFIER silent_mutation Average:49.328; most accessible tissue: Callus, score: 90.642 N N N N
vg0715273808 C -> A LOC_Os07g26500-LOC_Os07g26510 intergenic_region ; MODIFIER silent_mutation Average:49.328; most accessible tissue: Callus, score: 90.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715273808 NA 8.28E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 2.74E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 3.36E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 1.49E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 5.18E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 4.12E-06 NA mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 5.15E-06 NA mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 5.19E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 5.91E-06 8.89E-07 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 4.04E-07 2.96E-07 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 1.77E-06 NA mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 6.86E-07 7.17E-09 mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 2.09E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 2.07E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 1.42E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715273808 NA 8.01E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251