\
| Variant ID: vg0715259376 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15259376 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 49. )
GGTCACGTTTAGCGGCGACTGATTCGGTGCTAGCCTTCTCCTGTGTCTATGTTCTGGAGCTGTCAGTGTGTGGGTGGTGGTTATTTTCTTCTTTTTCTTG[G/A]
ATACGATCTTCCACGGTTGTAATCTTGTAATTTTTTCCTGCTCTATCAATATGAACTTCGCGCTGTCCGGTGCAAGTTCTTCGGAAAAAAACCTCTAAAG
CTTTAGAGGTTTTTTTCCGAAGAACTTGCACCGGACAGCGCGAAGTTCATATTGATAGAGCAGGAAAAAATTACAAGATTACAACCGTGGAAGATCGTAT[C/T]
CAAGAAAAAGAAGAAAATAACCACCACCCACACACTGACAGCTCCAGAACATAGACACAGGAGAAGGCTAGCACCGAATCAGTCGCCGCTAAACGTGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 46.80% | 0.23% | 3.66% | NA |
| All Indica | 2759 | 20.80% | 77.20% | 0.14% | 1.85% | NA |
| All Japonica | 1512 | 93.60% | 0.90% | 0.07% | 5.49% | NA |
| Aus | 269 | 87.00% | 7.80% | 1.12% | 4.09% | NA |
| Indica I | 595 | 11.10% | 88.60% | 0.17% | 0.17% | NA |
| Indica II | 465 | 13.50% | 85.80% | 0.00% | 0.65% | NA |
| Indica III | 913 | 18.20% | 81.40% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 35.40% | 58.80% | 0.13% | 5.73% | NA |
| Temperate Japonica | 767 | 88.30% | 1.20% | 0.13% | 10.43% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 54.20% | 14.60% | 3.12% | 28.12% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715259376 | G -> DEL | N | N | silent_mutation | Average:43.793; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| vg0715259376 | G -> A | LOC_Os07g26500-LOC_Os07g26510 | intergenic_region ; MODIFIER | silent_mutation | Average:43.793; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715259376 | NA | 3.98E-22 | mr1131 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 5.17E-19 | mr1199 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 2.30E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 2.08E-24 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 1.18E-09 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 1.54E-08 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 3.29E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 1.17E-13 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 2.23E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 4.14E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 1.09E-18 | mr1131_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 2.72E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715259376 | NA | 1.04E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |