Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715245766:

Variant ID: vg0715245766 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15245766
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCAATTTATGTGGTGTGTTTTTAGAGATGCATTTGGCTGGCAAAGGATCCCTGCTTCTAGAAGTGAAATCTCTAAGACCGAATTCAAGGCCTATGATC[T/C]
AGATTTCTATTGGGCCACGTGGCACCCTACGAATTTGGTTTGAATTCTTTTAGGAACTGCCACATGTTAAAGTGATGGGTGAAGTATCCGCATCGTGAGA

Reverse complement sequence

TCTCACGATGCGGATACTTCACCCATCACTTTAACATGTGGCAGTTCCTAAAAGAATTCAAACCAAATTCGTAGGGTGCCACGTGGCCCAATAGAAATCT[A/G]
GATCATAGGCCTTGAATTCGGTCTTAGAGATTTCACTTCTAGAAGCAGGGATCCTTTGCCAGCCAAATGCATCTCTAAAAACACACCACATAAATTGGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.60% 0.02% 0.19% NA
All Indica  2759 42.50% 57.10% 0.04% 0.33% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 51.90% 47.60% 0.00% 0.50% NA
Indica II  465 15.70% 84.30% 0.00% 0.00% NA
Indica III  913 38.30% 61.20% 0.00% 0.44% NA
Indica Intermediate  786 56.10% 43.50% 0.13% 0.25% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715245766 T -> DEL N N silent_mutation Average:76.902; most accessible tissue: Zhenshan97 root, score: 96.042 N N N N
vg0715245766 T -> C LOC_Os07g26490.1 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:76.902; most accessible tissue: Zhenshan97 root, score: 96.042 N N N N
vg0715245766 T -> C LOC_Os07g26490.2 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:76.902; most accessible tissue: Zhenshan97 root, score: 96.042 N N N N
vg0715245766 T -> C LOC_Os07g26500.1 downstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:76.902; most accessible tissue: Zhenshan97 root, score: 96.042 N N N N
vg0715245766 T -> C LOC_Os07g26500-LOC_Os07g26510 intergenic_region ; MODIFIER silent_mutation Average:76.902; most accessible tissue: Zhenshan97 root, score: 96.042 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0715245766 T C 0.03 0.12 0.08 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715245766 NA 7.20E-20 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0715245766 NA 3.75E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0715245766 NA 1.88E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.48E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 6.40E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.41E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.69E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.42E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.94E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.69E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.47E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.64E-07 mr1371 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.62E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.96E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.29E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.26E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.60E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.36E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 7.07E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 9.21E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.81E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 5.38E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 6.46E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.07E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 8.10E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 9.52E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.41E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 4.19E-15 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.77E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.17E-08 mr1349_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.56E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 9.42E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.58E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.02E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.99E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.63E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.15E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 3.23E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.16E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.46E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 7.47E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.79E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 2.72E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715245766 NA 1.07E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251