\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715227955:

Variant ID: vg0715227955 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15227955
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACCTTTGTTGCCATCGGTTAAATCCAACTTATATGTATATGCAATCCCTACAAGCCGATGCAACGTCCAGATAACTTATCGGCTAGCACCCCGATAAAA[T/C]
ATTAGCATGAACCTATCGGCTTAACAAGACTTATATTATCAACAATAATCTAGTAGATCGAACCTAACCGATGCAGCACGAGATTGTATATGATAATCTA

Reverse complement sequence

TAGATTATCATATACAATCTCGTGCTGCATCGGTTAGGTTCGATCTACTAGATTATTGTTGATAATATAAGTCTTGTTAAGCCGATAGGTTCATGCTAAT[A/G]
TTTTATCGGGGTGCTAGCCGATAAGTTATCTGGACGTTGCATCGGCTTGTAGGGATTGCATATACATATAAGTTGGATTTAACCGATGGCAACAAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 34.00% 0.91% 0.68% NA
All Indica  2759 96.30% 3.50% 0.22% 0.00% NA
All Japonica  1512 1.60% 93.80% 2.45% 2.12% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 95.90% 3.70% 0.43% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 7.80% 0.38% 0.00% NA
Temperate Japonica  767 2.00% 89.00% 4.82% 4.17% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715227955 T -> DEL N N silent_mutation Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0715227955 T -> C LOC_Os07g26470.1 upstream_gene_variant ; 686.0bp to feature; MODIFIER silent_mutation Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0715227955 T -> C LOC_Os07g26480.1 upstream_gene_variant ; 3010.0bp to feature; MODIFIER silent_mutation Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0715227955 T -> C LOC_Os07g26480.2 upstream_gene_variant ; 2997.0bp to feature; MODIFIER silent_mutation Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0715227955 T -> C LOC_Os07g26460.1 downstream_gene_variant ; 4892.0bp to feature; MODIFIER silent_mutation Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0715227955 T -> C LOC_Os07g26470-LOC_Os07g26480 intergenic_region ; MODIFIER silent_mutation Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715227955 NA 4.65E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.34E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 9.04E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 8.55E-06 8.55E-06 mr1205 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 2.04E-06 NA mr1215 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 3.66E-06 3.66E-06 mr1230 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 4.46E-13 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.78E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.19E-15 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 6.98E-06 NA mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 4.41E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 9.34E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 4.32E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 2.49E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 2.10E-06 1.57E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.68E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 2.33E-06 2.33E-06 mr1643 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.90E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 5.40E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 3.82E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 2.11E-06 NA mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 9.44E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 2.74E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.27E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.41E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.20E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 8.18E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 9.03E-12 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 4.77E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 3.38E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 5.97E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 1.63E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 2.21E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955 NA 2.61E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251