Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715227873:

Variant ID: vg0715227873 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15227873
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAATATTGATCCGAAGGATAAAGCATACATCGGCTGGAGGTCCGATGTCATAAGATCCACAAGATTAGATTAAACAGTGAAACCTTTGTTGCCATCGG[T/C]
TAAATCCAACTTATATGTATATGCAATCCCTACAAGCCGATGCAACGTCCAGATAACTTATCGGCTAGCACCCCGATAAAATATTAGCATGAACCTATCG

Reverse complement sequence

CGATAGGTTCATGCTAATATTTTATCGGGGTGCTAGCCGATAAGTTATCTGGACGTTGCATCGGCTTGTAGGGATTGCATATACATATAAGTTGGATTTA[A/G]
CCGATGGCAACAAAGGTTTCACTGTTTAATCTAATCTTGTGGATCTTATGACATCGGACCTCCAGCCGATGTATGCTTTATCCTTCGGATCAATATTTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.40%	0.06%	0.00%	NA
All Indica	2759	96.40%	3.40%	0.11%	0.00%	NA
All Japonica	1512	1.60%	98.40%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.60%	0.25%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715227873	T -> C	LOC_Os07g26470.1	upstream_gene_variant ; 604.0bp to feature; MODIFIER	silent_mutation	Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769	N	N	N	N
vg0715227873	T -> C	LOC_Os07g26480.1	upstream_gene_variant ; 3092.0bp to feature; MODIFIER	silent_mutation	Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769	N	N	N	N
vg0715227873	T -> C	LOC_Os07g26480.2	upstream_gene_variant ; 3079.0bp to feature; MODIFIER	silent_mutation	Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769	N	N	N	N
vg0715227873	T -> C	LOC_Os07g26460.1	downstream_gene_variant ; 4810.0bp to feature; MODIFIER	silent_mutation	Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769	N	N	N	N
vg0715227873	T -> C	LOC_Os07g26470-LOC_Os07g26480	intergenic_region ; MODIFIER	silent_mutation	Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715227873	NA	2.83E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	2.36E-31	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	4.53E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	4.27E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	5.92E-12	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	3.36E-06	NA	mr1468	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	5.13E-86	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	6.33E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	2.88E-70	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.70E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.47E-43	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	8.43E-19	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	8.61E-45	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	9.67E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	3.80E-61	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	3.51E-78	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	2.46E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	9.58E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	7.46E-31	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.64E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.22E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.76E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	7.64E-42	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.37E-43	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	6.13E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	3.76E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873	NA	1.00E-31	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251