\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715227873:

Variant ID: vg0715227873 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15227873
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAATATTGATCCGAAGGATAAAGCATACATCGGCTGGAGGTCCGATGTCATAAGATCCACAAGATTAGATTAAACAGTGAAACCTTTGTTGCCATCGG[T/C]
TAAATCCAACTTATATGTATATGCAATCCCTACAAGCCGATGCAACGTCCAGATAACTTATCGGCTAGCACCCCGATAAAATATTAGCATGAACCTATCG

Reverse complement sequence

CGATAGGTTCATGCTAATATTTTATCGGGGTGCTAGCCGATAAGTTATCTGGACGTTGCATCGGCTTGTAGGGATTGCATATACATATAAGTTGGATTTA[A/G]
CCGATGGCAACAAAGGTTTCACTGTTTAATCTAATCTTGTGGATCTTATGACATCGGACCTCCAGCCGATGTATGCTTTATCCTTCGGATCAATATTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.40% 0.06% 0.00% NA
All Indica  2759 96.40% 3.40% 0.11% 0.00% NA
All Japonica  1512 1.60% 98.40% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.60% 0.25% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715227873 T -> C LOC_Os07g26470.1 upstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N
vg0715227873 T -> C LOC_Os07g26480.1 upstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N
vg0715227873 T -> C LOC_Os07g26480.2 upstream_gene_variant ; 3079.0bp to feature; MODIFIER silent_mutation Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N
vg0715227873 T -> C LOC_Os07g26460.1 downstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N
vg0715227873 T -> C LOC_Os07g26470-LOC_Os07g26480 intergenic_region ; MODIFIER silent_mutation Average:15.681; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715227873 NA 2.83E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 2.36E-31 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 4.53E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 4.27E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 5.92E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 3.36E-06 NA mr1468 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 5.13E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 6.33E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 2.88E-70 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.70E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.47E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 8.43E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 8.61E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 9.67E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 3.80E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 3.51E-78 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 2.46E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 9.58E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 7.46E-31 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.64E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.22E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.76E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 7.64E-42 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.37E-43 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 6.13E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 3.76E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227873 NA 1.00E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251