\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715209847:

Variant ID: vg0715209847 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 15209847
Reference Allele: TAlternative Allele: TGG,TTGG,C,G,TTG
Primary Allele: TSecondary Allele: TGG

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CTCAATAATAGGTTATGATGTCACATCAAACTCCATAATGACTACATTCTAAATTCTAAAACAGTCAGATCGGACTGCAGCTTCCTCTTCTTTTTTTTTT[T/TGG,TTGG,C,G,TTG]
TGTGTGTGTGTGTGGCCCAATGGAAAGCTGTTACAGATGTATGCGTTCCCCAGAGGACACAAGCAAGCACCATTCAATGCATCATGATAAATAACAACAA

Reverse complement sequence

TTGTTGTTATTTATCATGATGCATTGAATGGTGCTTGCTTGTGTCCTCTGGGGAACGCATACATCTGTAACAGCTTTCCATTGGGCCACACACACACACA[A/CCA,CCAA,G,C,CAA]
AAAAAAAAAAGAAGAGGAAGCTGCAGTCCGATCTGACTGTTTTAGAATTTAGAATGTAGTCATTATGGAGTTTGATGTGACATCATAACCTATTATTGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 33.70% 1.42% 0.25% TTGG: 5.56%; G: 2.86%; C: 2.26%; TTG: 0.06%
All Indica  2759 37.50% 55.40% 0.54% 0.43% G: 3.33%; C: 1.78%; TTGG: 0.91%; TTG: 0.11%
All Japonica  1512 88.20% 0.70% 2.98% 0.00% TTGG: 5.22%; G: 2.71%; C: 0.20%
Aus  269 26.80% 6.70% 2.23% 0.00% TTGG: 58.74%; C: 5.58%
Indica I  595 48.20% 43.50% 0.34% 0.67% C: 6.22%; G: 1.01%
Indica II  465 21.10% 76.60% 0.86% 0.22% G: 0.86%; C: 0.22%; TTGG: 0.22%
Indica III  913 33.10% 64.60% 0.33% 0.44% TTGG: 0.55%; G: 0.44%; TTG: 0.33%; C: 0.22%
Indica Intermediate  786 44.30% 41.10% 0.76% 0.38% G: 9.92%; TTGG: 2.42%; C: 1.15%
Temperate Japonica  767 83.30% 0.90% 2.74% 0.00% TTGG: 10.17%; G: 2.87%
Tropical Japonica  504 97.40% 0.20% 1.98% 0.00% G: 0.40%
Japonica Intermediate  241 84.60% 0.80% 5.81% 0.00% G: 7.05%; C: 1.24%; TTGG: 0.41%
VI/Aromatic  96 47.90% 12.50% 0.00% 0.00% C: 39.58%
Intermediate  90 63.30% 30.00% 1.11% 0.00% C: 2.22%; G: 2.22%; TTGG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715209847 T -> C LOC_Os07g26450.1 upstream_gene_variant ; 4775.0bp to feature; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> C LOC_Os07g26440.1 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> C LOC_Os07g26440.2 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> C LOC_Os07g26440.3 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TGG LOC_Os07g26450.1 upstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TGG LOC_Os07g26440.1 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TGG LOC_Os07g26440.2 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TGG LOC_Os07g26440.3 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTG LOC_Os07g26450.1 upstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTG LOC_Os07g26440.1 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTG LOC_Os07g26440.2 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTG LOC_Os07g26440.3 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> G LOC_Os07g26450.1 upstream_gene_variant ; 4775.0bp to feature; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> G LOC_Os07g26440.1 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> G LOC_Os07g26440.2 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> G LOC_Os07g26440.3 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTGG LOC_Os07g26450.1 upstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTGG LOC_Os07g26440.1 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTGG LOC_Os07g26440.2 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> TTGG LOC_Os07g26440.3 intron_variant ; MODIFIER silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N
vg0715209847 T -> DEL N N silent_mutation Average:74.021; most accessible tissue: Zhenshan97 root, score: 95.629 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0715209847 T C -0.16 -0.01 0.01 0.03 0.0 -0.03
vg0715209847 T G -0.04 0.01 0.0 0.01 0.01 0.02
vg0715209847 T TGG -0.24 0.0 0.03 0.15 0.19 0.26
vg0715209847 T TTG -0.1 0.03 0.05 0.14 0.2 0.25
vg0715209847 T TTGG -0.27 -0.08 -0.03 0.11 0.15 0.26

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715209847 1.73E-06 1.73E-06 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715209847 8.24E-06 6.71E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251