\
| Variant ID: vg0715152264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15152264 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGGGCATCAGTCAAACTTAAGCTGTAGCACTTATTCCTCATCTCTCCGAATCTCTGAATATATTCATGCACAGGCTCATCATGTCTTTGCTTGATTGAT[G/A]
TCAGATCGGACAATTTCATCTCATGAACCCCACTTTAAAAATAGTTGTGAAACTATTTTTTTAAATCGGCCCAACTGTTAATTGATCCATATGGTAAAGA
TCTTTACCATATGGATCAATTAACAGTTGGGCCGATTTAAAAAAATAGTTTCACAACTATTTTTAAAGTGGGGTTCATGAGATGAAATTGTCCGATCTGA[C/T]
ATCAATCAAGCAAAGACATGATGAGCCTGTGCATGAATATATTCAGAGATTCGGAGAGATGAGGAATAAGTGCTACAGCTTAAGTTTGACTGATGCCCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.80% | 5.70% | 25.77% | 29.71% | NA |
| All Indica | 2759 | 18.00% | 0.00% | 35.77% | 46.21% | NA |
| All Japonica | 1512 | 77.00% | 17.30% | 3.70% | 2.05% | NA |
| Aus | 269 | 29.00% | 0.00% | 48.33% | 22.68% | NA |
| Indica I | 595 | 21.50% | 0.20% | 45.38% | 32.94% | NA |
| Indica II | 465 | 27.50% | 0.00% | 37.20% | 35.27% | NA |
| Indica III | 913 | 6.20% | 0.00% | 26.62% | 67.14% | NA |
| Indica Intermediate | 786 | 23.30% | 0.00% | 38.30% | 38.42% | NA |
| Temperate Japonica | 767 | 91.50% | 0.40% | 4.95% | 3.13% | NA |
| Tropical Japonica | 504 | 45.80% | 50.40% | 3.17% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.70% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 51.00% | 0.00% | 27.08% | 21.88% | NA |
| Intermediate | 90 | 52.20% | 8.90% | 21.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715152264 | G -> DEL | N | N | silent_mutation | Average:17.362; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0715152264 | G -> A | LOC_Os07g26350.1 | downstream_gene_variant ; 4842.0bp to feature; MODIFIER | silent_mutation | Average:17.362; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0715152264 | G -> A | LOC_Os07g26370.1 | downstream_gene_variant ; 3473.0bp to feature; MODIFIER | silent_mutation | Average:17.362; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0715152264 | G -> A | LOC_Os07g26360.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.362; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715152264 | NA | 1.01E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 7.31E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | 2.40E-06 | NA | mr1159_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 4.08E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 2.35E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 6.16E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 5.02E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 3.73E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 2.02E-10 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 2.56E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 1.82E-08 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715152264 | NA | 1.56E-15 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |