Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715036888:

Variant ID: vg0715036888 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15036888
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

GGTAGATGTTCACCGGTTAATATTTTGCTCTTATAAATGTCTCAAACTTAGCGTACGAAGTATGCCCGCGCATTCGCGCGGGCGATAAACGGCGTCTAAG[T/C]
TTCTACTATTCAAATGTAACATAATGGTGAAGTGGTGACCTTAAATAGATCTACTTTTTTTTATCACTGCTAAGATAAACTCATGGTACATATTTCCAAT

Reverse complement sequence

ATTGGAAATATGTACCATGAGTTTATCTTAGCAGTGATAAAAAAAAGTAGATCTATTTAAGGTCACCACTTCACCATTATGTTACATTTGAATAGTAGAA[A/G]
CTTAGACGCCGTTTATCGCCCGCGCGAATGCGCGGGCATACTTCGTACGCTAAGTTTGAGACATTTATAAGAGCAAAATATTAACCGGTGAACATCTACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	2.70%	0.59%	38.24%	NA
All Indica	2759	37.80%	4.40%	0.98%	56.87%	NA
All Japonica	1512	98.70%	0.50%	0.07%	0.73%	NA
Aus	269	30.10%	0.00%	0.00%	69.89%	NA
Indica I	595	48.60%	5.00%	2.52%	43.87%	NA
Indica II	465	20.40%	1.10%	0.22%	78.28%	NA
Indica III	913	33.70%	0.40%	0.22%	65.61%	NA
Indica Intermediate	786	44.50%	10.40%	1.15%	43.89%	NA
Temperate Japonica	767	98.00%	0.90%	0.13%	0.91%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	87.50%	0.00%	0.00%	12.50%	NA
Intermediate	90	70.00%	0.00%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715036888	T -> DEL	N	N	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0715036888	T -> C	LOC_Os07g26160.1	upstream_gene_variant ; 3496.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0715036888	T -> C	LOC_Os07g26150.1	downstream_gene_variant ; 3087.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0715036888	T -> C	LOC_Os07g26150-LOC_Os07g26160	intergenic_region ; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715036888	3.17E-06	3.17E-06	mr1369_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715036888	1.59E-06	1.59E-06	mr1453_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715036888	NA	7.46E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251