\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715027149:

Variant ID: vg0715027149 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15027149
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.06, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


GACTACAATTCGTTGGAGCGACCGAAACGATCTACAACTAGACTATCTCAAAATGTTAGGCCTCGCCTAAGTGCAAGTTCTTATCAATTATATACTAAAA[G/A]
TCCATTAAACTTTCTAGAAACGCTCTTAAGCCGCCACGTGACGTTCTTACAAATACAATTAGACCGCCACATGGCACTATTTAATCTTACCGTTAATTTC

Reverse complement sequence

GAAATTAACGGTAAGATTAAATAGTGCCATGTGGCGGTCTAATTGTATTTGTAAGAACGTCACGTGGCGGCTTAAGAGCGTTTCTAGAAAGTTTAATGGA[C/T]
TTTTAGTATATAATTGATAAGAACTTGCACTTAGGCGAGGCCTAACATTTTGAGATAGTCTAGTTGTAGATCGTTTCGGTCGCTCCAACGAATTGTAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 43.10% 0.17% 5.99% NA
All Indica  2759 24.80% 69.70% 0.29% 5.26% NA
All Japonica  1512 93.70% 0.70% 0.00% 5.62% NA
Aus  269 71.40% 23.40% 0.00% 5.20% NA
Indica I  595 19.50% 72.30% 0.50% 7.73% NA
Indica II  465 14.60% 84.50% 0.22% 0.65% NA
Indica III  913 28.40% 70.80% 0.00% 0.88% NA
Indica Intermediate  786 30.70% 57.60% 0.51% 11.20% NA
Temperate Japonica  767 88.40% 0.90% 0.00% 10.69% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 0.00% 1.24% NA
VI/Aromatic  96 47.90% 12.50% 0.00% 39.58% NA
Intermediate  90 67.80% 31.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715027149 G -> DEL N N silent_mutation Average:58.663; most accessible tissue: Zhenshan97 flower, score: 79.196 N N N N
vg0715027149 G -> A LOC_Os07g26140.1 downstream_gene_variant ; 3816.0bp to feature; MODIFIER silent_mutation Average:58.663; most accessible tissue: Zhenshan97 flower, score: 79.196 N N N N
vg0715027149 G -> A LOC_Os07g26140-LOC_Os07g26150 intergenic_region ; MODIFIER silent_mutation Average:58.663; most accessible tissue: Zhenshan97 flower, score: 79.196 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715027149 NA 2.93E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 7.10E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 4.00E-13 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 3.46E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 5.76E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 3.74E-14 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 7.98E-06 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 5.14E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 3.93E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 6.00E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 2.39E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 2.15E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 5.89E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 4.58E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 9.31E-18 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 1.52E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 9.78E-07 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 3.46E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 1.06E-08 mr1888 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 5.10E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715027149 NA 3.37E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251