Variant ID: vg0715026108 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 15026108 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.27, others allele: 0.00, population size: 195. )
GAAGGCCGTGGGCCTCAGCTATATCTCTCCCTGCTAAATGGGAGAACAGCGCGCCTACTCACATCTCACTATGCAGATAATGCCACGATGTTCATCTGAC[C/T]
GACAAAGAGAGATATGAGACACCTCGCTCGAATTCGGCATTCCTTGGGGAAAGTTATGGGCCTCTAAACCAACATGGTGAAAAGTCAGATTCTGCGGCGC
GCGCCGCAGAATCTGACTTTTCACCATGTTGGTTTAGAGGCCCATAACTTTCCCCAAGGAATGCCGAATTCGAGCGAGGTGTCTCATATCTCTCTTTGTC[G/A]
GTCAGATGAACATCGTGGCATTATCTGCATAGTGAGATGTGAGTAGGCGCGCTGTTCTCCCATTTAGCAGGGAGAGATATAGCTGAGGCCCACGGCCTTC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.10% | 5.90% | 0.02% | 0.00% | NA |
All Indica | 2759 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 94.20% | 5.70% | 0.07% | 0.00% | NA |
Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0715026108 | C -> T | LOC_Os07g26140.1 | downstream_gene_variant ; 2775.0bp to feature; MODIFIER | silent_mutation | Average:54.519; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
vg0715026108 | C -> T | LOC_Os07g26140-LOC_Os07g26150 | intergenic_region ; MODIFIER | silent_mutation | Average:54.519; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0715026108 | NA | 7.89E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0715026108 | 3.11E-06 | 3.11E-06 | mr1369_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0715026108 | 1.86E-06 | 1.86E-06 | mr1453_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0715026108 | 6.24E-06 | 3.53E-06 | mr1832_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0715026108 | 4.42E-06 | 1.95E-06 | mr1833_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |