\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714987440:

Variant ID: vg0714987440 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14987440
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAACACAAAATCAATTTAGTCAAAGCTTGTAACGTACCATTTGGAATGGAACTTGCAGTAAGACAGCAAATTCAAAATTGGCAGGGCCGAAATAATCG[A/G]
TTCTTAATTAGATTTTGAATTAACTAGCTAGCTTGGGGAAATACTAGATTCAACTATGAGAGCTACTAATGTTATTAAAGAGAAGATGAAATATATATTA

Reverse complement sequence

TAATATATATTTCATCTTCTCTTTAATAACATTAGTAGCTCTCATAGTTGAATCTAGTATTTCCCCAAGCTAGCTAGTTAATTCAAAATCTAATTAAGAA[T/C]
CGATTATTTCGGCCCTGCCAATTTTGAATTTGCTGTCTTACTGCAAGTTCCATTCCAAATGGTACGTTACAAGCTTTGACTAAATTGATTTTGTGTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.00% 0.74% 0.00% NA
All Indica  2759 96.10% 2.80% 1.16% 0.00% NA
All Japonica  1512 1.50% 98.50% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 94.50% 1.70% 3.87% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 4.20% 1.02% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714987440 A -> G LOC_Os07g26110.1 upstream_gene_variant ; 1123.0bp to feature; MODIFIER silent_mutation Average:48.873; most accessible tissue: Callus, score: 71.434 N N N N
vg0714987440 A -> G LOC_Os07g26100-LOC_Os07g26110 intergenic_region ; MODIFIER silent_mutation Average:48.873; most accessible tissue: Callus, score: 71.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714987440 NA 1.41E-69 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 1.46E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 9.01E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 1.98E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 4.73E-44 mr1645 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 1.19E-36 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 7.45E-37 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 2.26E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 1.33E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 7.02E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 3.16E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 1.74E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 1.61E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 5.05E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714987440 NA 2.34E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251