\
| Variant ID: vg0714895102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14895102 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTAAAACCGTAGAGACACGGAGTCTTCGACAATGTTGAATAGAACTTTCCTGAAATCAATACTCAAAATAGAATATTAAATAGAAATAGCCCCCGAGCGA[A/G]
CGCTTAAGGGCAACATGTTATAATATGTATGGAAATATTTGAAAATAAATTGAATCTGCGTGTGACAATAAAAGAGTACGCTCGCTAGAGTTGCCCTCTG
CAGAGGGCAACTCTAGCGAGCGTACTCTTTTATTGTCACACGCAGATTCAATTTATTTTCAAATATTTCCATACATATTATAACATGTTGCCCTTAAGCG[T/C]
TCGCTCGGGGGCTATTTCTATTTAATATTCTATTTTGAGTATTGATTTCAGGAAAGTTCTATTCAACATTGTCGAAGACTCCGTGTCTCTACGGTTTTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 1.60% | 6.01% | 19.32% | NA |
| All Indica | 2759 | 61.30% | 2.70% | 9.79% | 26.21% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.07% | 0.46% | NA |
| Aus | 269 | 39.40% | 0.40% | 4.09% | 56.13% | NA |
| Indica I | 595 | 63.20% | 0.70% | 6.39% | 29.75% | NA |
| Indica II | 465 | 59.10% | 2.20% | 12.47% | 26.24% | NA |
| Indica III | 913 | 58.60% | 4.10% | 12.60% | 24.75% | NA |
| Indica Intermediate | 786 | 64.40% | 2.90% | 7.51% | 25.19% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 75.60% | 1.10% | 2.22% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714895102 | A -> DEL | N | N | silent_mutation | Average:11.162; most accessible tissue: Callus, score: 19.961 | N | N | N | N |
| vg0714895102 | A -> G | LOC_Os07g25950.1 | downstream_gene_variant ; 2118.0bp to feature; MODIFIER | silent_mutation | Average:11.162; most accessible tissue: Callus, score: 19.961 | N | N | N | N |
| vg0714895102 | A -> G | LOC_Os07g25960.1 | downstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:11.162; most accessible tissue: Callus, score: 19.961 | N | N | N | N |
| vg0714895102 | A -> G | LOC_Os07g25950-LOC_Os07g25960 | intergenic_region ; MODIFIER | silent_mutation | Average:11.162; most accessible tissue: Callus, score: 19.961 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714895102 | NA | 1.57E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714895102 | NA | 8.54E-08 | mr1600 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714895102 | NA | 3.20E-06 | mr1600 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |