Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714895102:

Variant ID: vg0714895102 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14895102
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAAAACCGTAGAGACACGGAGTCTTCGACAATGTTGAATAGAACTTTCCTGAAATCAATACTCAAAATAGAATATTAAATAGAAATAGCCCCCGAGCGA[A/G]
CGCTTAAGGGCAACATGTTATAATATGTATGGAAATATTTGAAAATAAATTGAATCTGCGTGTGACAATAAAAGAGTACGCTCGCTAGAGTTGCCCTCTG

Reverse complement sequence

CAGAGGGCAACTCTAGCGAGCGTACTCTTTTATTGTCACACGCAGATTCAATTTATTTTCAAATATTTCCATACATATTATAACATGTTGCCCTTAAGCG[T/C]
TCGCTCGGGGGCTATTTCTATTTAATATTCTATTTTGAGTATTGATTTCAGGAAAGTTCTATTCAACATTGTCGAAGACTCCGTGTCTCTACGGTTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	1.60%	6.01%	19.32%	NA
All Indica	2759	61.30%	2.70%	9.79%	26.21%	NA
All Japonica	1512	99.50%	0.00%	0.07%	0.46%	NA
Aus	269	39.40%	0.40%	4.09%	56.13%	NA
Indica I	595	63.20%	0.70%	6.39%	29.75%	NA
Indica II	465	59.10%	2.20%	12.47%	26.24%	NA
Indica III	913	58.60%	4.10%	12.60%	24.75%	NA
Indica Intermediate	786	64.40%	2.90%	7.51%	25.19%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	75.60%	1.10%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714895102	A -> DEL	N	N	silent_mutation	Average:11.162; most accessible tissue: Callus, score: 19.961	N	N	N	N
vg0714895102	A -> G	LOC_Os07g25950.1	downstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:11.162; most accessible tissue: Callus, score: 19.961	N	N	N	N
vg0714895102	A -> G	LOC_Os07g25960.1	downstream_gene_variant ; 4785.0bp to feature; MODIFIER	silent_mutation	Average:11.162; most accessible tissue: Callus, score: 19.961	N	N	N	N
vg0714895102	A -> G	LOC_Os07g25950-LOC_Os07g25960	intergenic_region ; MODIFIER	silent_mutation	Average:11.162; most accessible tissue: Callus, score: 19.961	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714895102	NA	1.57E-06	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714895102	NA	8.54E-08	mr1600	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714895102	NA	3.20E-06	mr1600	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251