\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714895102:

Variant ID: vg0714895102 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14895102
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAAAACCGTAGAGACACGGAGTCTTCGACAATGTTGAATAGAACTTTCCTGAAATCAATACTCAAAATAGAATATTAAATAGAAATAGCCCCCGAGCGA[A/G]
CGCTTAAGGGCAACATGTTATAATATGTATGGAAATATTTGAAAATAAATTGAATCTGCGTGTGACAATAAAAGAGTACGCTCGCTAGAGTTGCCCTCTG

Reverse complement sequence

CAGAGGGCAACTCTAGCGAGCGTACTCTTTTATTGTCACACGCAGATTCAATTTATTTTCAAATATTTCCATACATATTATAACATGTTGCCCTTAAGCG[T/C]
TCGCTCGGGGGCTATTTCTATTTAATATTCTATTTTGAGTATTGATTTCAGGAAAGTTCTATTCAACATTGTCGAAGACTCCGTGTCTCTACGGTTTTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 1.60% 6.01% 19.32% NA
All Indica  2759 61.30% 2.70% 9.79% 26.21% NA
All Japonica  1512 99.50% 0.00% 0.07% 0.46% NA
Aus  269 39.40% 0.40% 4.09% 56.13% NA
Indica I  595 63.20% 0.70% 6.39% 29.75% NA
Indica II  465 59.10% 2.20% 12.47% 26.24% NA
Indica III  913 58.60% 4.10% 12.60% 24.75% NA
Indica Intermediate  786 64.40% 2.90% 7.51% 25.19% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 75.60% 1.10% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714895102 A -> DEL N N silent_mutation Average:11.162; most accessible tissue: Callus, score: 19.961 N N N N
vg0714895102 A -> G LOC_Os07g25950.1 downstream_gene_variant ; 2118.0bp to feature; MODIFIER silent_mutation Average:11.162; most accessible tissue: Callus, score: 19.961 N N N N
vg0714895102 A -> G LOC_Os07g25960.1 downstream_gene_variant ; 4785.0bp to feature; MODIFIER silent_mutation Average:11.162; most accessible tissue: Callus, score: 19.961 N N N N
vg0714895102 A -> G LOC_Os07g25950-LOC_Os07g25960 intergenic_region ; MODIFIER silent_mutation Average:11.162; most accessible tissue: Callus, score: 19.961 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714895102 NA 1.57E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714895102 NA 8.54E-08 mr1600 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714895102 NA 3.20E-06 mr1600 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251