Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714880390:

Variant ID: vg0714880390 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14880390
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGGTCCGTCTGCCAGTCTCTTGGAAGAAGCTGGGGGCCAGAAGAGCCCATAGGGGGTCGACTGACCCCTTGTTGAGCCCAATCCAGCCGCATTTTGGC[T/C,A]
AGGAGATAAGGGAGGCCGAGGAGGAAGCAGCAGGCCAAAAACCAGGCCTGTTGGGCCAAAAACCTAGGGTTGGTTCGGCCAAACCTTGATCTCAGCTGTT

Reverse complement sequence

AACAGCTGAGATCAAGGTTTGGCCGAACCAACCCTAGGTTTTTGGCCCAACAGGCCTGGTTTTTGGCCTGCTGCTTCCTCCTCGGCCTCCCTTATCTCCT[A/G,T]
GCCAAAATGCGGCTGGATTGGGCTCAACAAGGGGTCAGTCGACCCCCTATGGGCTCTTCTGGCCCCCAGCTTCTTCCAAGAGACTGGCAGACGGACCCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	5.10%	0.66%	53.70%	A: 0.08%
All Indica	2759	14.00%	3.20%	0.72%	81.99%	A: 0.11%
All Japonica	1512	92.50%	6.30%	0.53%	0.66%	NA
Aus	269	12.60%	5.20%	0.00%	81.78%	A: 0.37%
Indica I	595	24.90%	0.80%	0.84%	73.45%	NA
Indica II	465	19.80%	1.10%	0.43%	78.71%	NA
Indica III	913	2.60%	0.50%	0.88%	95.62%	A: 0.33%
Indica Intermediate	786	15.50%	9.30%	0.64%	74.55%	NA
Temperate Japonica	767	86.20%	12.10%	1.04%	0.65%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	97.50%	1.20%	0.00%	1.24%	NA
VI/Aromatic	96	45.80%	40.60%	0.00%	13.54%	NA
Intermediate	90	55.60%	4.40%	3.33%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714880390	T -> DEL	N	N	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> A	LOC_Os07g25910.1	upstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> A	LOC_Os07g25920.1	upstream_gene_variant ; 531.0bp to feature; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> A	LOC_Os07g25930.1	upstream_gene_variant ; 1650.0bp to feature; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> A	LOC_Os07g25920-LOC_Os07g25930	intergenic_region ; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> C	LOC_Os07g25910.1	upstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> C	LOC_Os07g25920.1	upstream_gene_variant ; 531.0bp to feature; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> C	LOC_Os07g25930.1	upstream_gene_variant ; 1650.0bp to feature; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N
vg0714880390	T -> C	LOC_Os07g25920-LOC_Os07g25930	intergenic_region ; MODIFIER	silent_mutation	Average:11.79; most accessible tissue: Callus, score: 40.063	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714880390	2.57E-06	2.57E-06	mr1004_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714880390	8.39E-06	NA	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714880390	1.42E-06	3.55E-07	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714880390	3.31E-06	3.31E-06	mr1754_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251