\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714880390:

Variant ID: vg0714880390 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14880390
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGGTCCGTCTGCCAGTCTCTTGGAAGAAGCTGGGGGCCAGAAGAGCCCATAGGGGGTCGACTGACCCCTTGTTGAGCCCAATCCAGCCGCATTTTGGC[T/C,A]
AGGAGATAAGGGAGGCCGAGGAGGAAGCAGCAGGCCAAAAACCAGGCCTGTTGGGCCAAAAACCTAGGGTTGGTTCGGCCAAACCTTGATCTCAGCTGTT

Reverse complement sequence

AACAGCTGAGATCAAGGTTTGGCCGAACCAACCCTAGGTTTTTGGCCCAACAGGCCTGGTTTTTGGCCTGCTGCTTCCTCCTCGGCCTCCCTTATCTCCT[A/G,T]
GCCAAAATGCGGCTGGATTGGGCTCAACAAGGGGTCAGTCGACCCCCTATGGGCTCTTCTGGCCCCCAGCTTCTTCCAAGAGACTGGCAGACGGACCCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 5.10% 0.66% 53.70% A: 0.08%
All Indica  2759 14.00% 3.20% 0.72% 81.99% A: 0.11%
All Japonica  1512 92.50% 6.30% 0.53% 0.66% NA
Aus  269 12.60% 5.20% 0.00% 81.78% A: 0.37%
Indica I  595 24.90% 0.80% 0.84% 73.45% NA
Indica II  465 19.80% 1.10% 0.43% 78.71% NA
Indica III  913 2.60% 0.50% 0.88% 95.62% A: 0.33%
Indica Intermediate  786 15.50% 9.30% 0.64% 74.55% NA
Temperate Japonica  767 86.20% 12.10% 1.04% 0.65% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 45.80% 40.60% 0.00% 13.54% NA
Intermediate  90 55.60% 4.40% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714880390 T -> DEL N N silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> A LOC_Os07g25910.1 upstream_gene_variant ; 2431.0bp to feature; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> A LOC_Os07g25920.1 upstream_gene_variant ; 531.0bp to feature; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> A LOC_Os07g25930.1 upstream_gene_variant ; 1650.0bp to feature; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> A LOC_Os07g25920-LOC_Os07g25930 intergenic_region ; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> C LOC_Os07g25910.1 upstream_gene_variant ; 2431.0bp to feature; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> C LOC_Os07g25920.1 upstream_gene_variant ; 531.0bp to feature; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> C LOC_Os07g25930.1 upstream_gene_variant ; 1650.0bp to feature; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N
vg0714880390 T -> C LOC_Os07g25920-LOC_Os07g25930 intergenic_region ; MODIFIER silent_mutation Average:11.79; most accessible tissue: Callus, score: 40.063 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714880390 2.57E-06 2.57E-06 mr1004_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714880390 8.39E-06 NA mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714880390 1.42E-06 3.55E-07 mr1528_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714880390 3.31E-06 3.31E-06 mr1754_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251