\
| Variant ID: vg0714880390 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14880390 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGGGTCCGTCTGCCAGTCTCTTGGAAGAAGCTGGGGGCCAGAAGAGCCCATAGGGGGTCGACTGACCCCTTGTTGAGCCCAATCCAGCCGCATTTTGGC[T/C,A]
AGGAGATAAGGGAGGCCGAGGAGGAAGCAGCAGGCCAAAAACCAGGCCTGTTGGGCCAAAAACCTAGGGTTGGTTCGGCCAAACCTTGATCTCAGCTGTT
AACAGCTGAGATCAAGGTTTGGCCGAACCAACCCTAGGTTTTTGGCCCAACAGGCCTGGTTTTTGGCCTGCTGCTTCCTCCTCGGCCTCCCTTATCTCCT[A/G,T]
GCCAAAATGCGGCTGGATTGGGCTCAACAAGGGGTCAGTCGACCCCCTATGGGCTCTTCTGGCCCCCAGCTTCTTCCAAGAGACTGGCAGACGGACCCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.50% | 5.10% | 0.66% | 53.70% | A: 0.08% |
| All Indica | 2759 | 14.00% | 3.20% | 0.72% | 81.99% | A: 0.11% |
| All Japonica | 1512 | 92.50% | 6.30% | 0.53% | 0.66% | NA |
| Aus | 269 | 12.60% | 5.20% | 0.00% | 81.78% | A: 0.37% |
| Indica I | 595 | 24.90% | 0.80% | 0.84% | 73.45% | NA |
| Indica II | 465 | 19.80% | 1.10% | 0.43% | 78.71% | NA |
| Indica III | 913 | 2.60% | 0.50% | 0.88% | 95.62% | A: 0.33% |
| Indica Intermediate | 786 | 15.50% | 9.30% | 0.64% | 74.55% | NA |
| Temperate Japonica | 767 | 86.20% | 12.10% | 1.04% | 0.65% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 45.80% | 40.60% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 55.60% | 4.40% | 3.33% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714880390 | T -> DEL | N | N | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> A | LOC_Os07g25910.1 | upstream_gene_variant ; 2431.0bp to feature; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> A | LOC_Os07g25920.1 | upstream_gene_variant ; 531.0bp to feature; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> A | LOC_Os07g25930.1 | upstream_gene_variant ; 1650.0bp to feature; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> A | LOC_Os07g25920-LOC_Os07g25930 | intergenic_region ; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> C | LOC_Os07g25910.1 | upstream_gene_variant ; 2431.0bp to feature; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> C | LOC_Os07g25920.1 | upstream_gene_variant ; 531.0bp to feature; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> C | LOC_Os07g25930.1 | upstream_gene_variant ; 1650.0bp to feature; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| vg0714880390 | T -> C | LOC_Os07g25920-LOC_Os07g25930 | intergenic_region ; MODIFIER | silent_mutation | Average:11.79; most accessible tissue: Callus, score: 40.063 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714880390 | 2.57E-06 | 2.57E-06 | mr1004_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714880390 | 8.39E-06 | NA | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714880390 | 1.42E-06 | 3.55E-07 | mr1528_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714880390 | 3.31E-06 | 3.31E-06 | mr1754_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |