\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714864470:

Variant ID: vg0714864470 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14864470
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTATACTGTTTGAAAATTGGGAACAGCGCCAAACGGGCAGACAAAGTTGATTTGGATCCAATAACGAAACATCCCAGCACGAATCTTGGAGCCGGATC[A/G]
AACAGCCAACAAATCGACAGTGTTTAGCGCTGAAAACTGTCGACAGATAAGTAGCAAAACCGTTTGTTTTTCACTCACCTTAACTTTGCATCTGACGGCA

Reverse complement sequence

TGCCGTCAGATGCAAAGTTAAGGTGAGTGAAAAACAAACGGTTTTGCTACTTATCTGTCGACAGTTTTCAGCGCTAAACACTGTCGATTTGTTGGCTGTT[T/C]
GATCCGGCTCCAAGATTCGTGCTGGGATGTTTCGTTATTGGATCCAAATCAACTTTGTCTGCCCGTTTGGCGCTGTTCCCAATTTTCAAACAGTATAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 36.60% 1.63% 10.90% NA
All Indica  2759 81.70% 9.00% 1.27% 8.08% NA
All Japonica  1512 1.70% 90.30% 2.38% 5.62% NA
Aus  269 19.30% 10.80% 1.12% 68.77% NA
Indica I  595 67.10% 16.10% 2.86% 13.95% NA
Indica II  465 80.40% 12.90% 1.51% 5.16% NA
Indica III  913 95.30% 0.80% 0.22% 3.72% NA
Indica Intermediate  786 77.70% 10.70% 1.15% 10.43% NA
Temperate Japonica  767 2.30% 95.20% 1.04% 1.43% NA
Tropical Japonica  504 0.40% 86.30% 5.16% 8.13% NA
Japonica Intermediate  241 2.50% 83.00% 0.83% 13.69% NA
VI/Aromatic  96 42.70% 45.80% 0.00% 11.46% NA
Intermediate  90 35.60% 48.90% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714864470 A -> DEL N N silent_mutation Average:46.175; most accessible tissue: Callus, score: 95.142 N N N N
vg0714864470 A -> G LOC_Os07g25890.1 upstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:46.175; most accessible tissue: Callus, score: 95.142 N N N N
vg0714864470 A -> G LOC_Os07g25880.1 downstream_gene_variant ; 1114.0bp to feature; MODIFIER silent_mutation Average:46.175; most accessible tissue: Callus, score: 95.142 N N N N
vg0714864470 A -> G LOC_Os07g25900.1 downstream_gene_variant ; 3994.0bp to feature; MODIFIER silent_mutation Average:46.175; most accessible tissue: Callus, score: 95.142 N N N N
vg0714864470 A -> G LOC_Os07g25880-LOC_Os07g25890 intergenic_region ; MODIFIER silent_mutation Average:46.175; most accessible tissue: Callus, score: 95.142 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0714864470 A G 0.08 0.16 0.12 0.1 0.11 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714864470 NA 2.15E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 9.38E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 6.60E-22 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 1.51E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 1.62E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 4.84E-34 mr1737 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 2.50E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714864470 NA 1.08E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251