\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714860463:

Variant ID: vg0714860463 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14860463
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCCAAGTTGTTCTTCATGAAAAGTTAGGGTGACTTGAGTCAAGATTGTTCCATTTCTCAATTGCTCAGGATCGCATGGTAGACACTACAAAGACCCA[G/C]
AAGTACAGGTATGGCTTTGAATAATTTGTTTGCATGATTATTAATAAGGAAGTCATAACTTTGTTGTAGAGTCCATAGCCTTCACTCGAGACGAGCAAAG

Reverse complement sequence

CTTTGCTCGTCTCGAGTGAAGGCTATGGACTCTACAACAAAGTTATGACTTCCTTATTAATAATCATGCAAACAAATTATTCAAAGCCATACCTGTACTT[C/G]
TGGGTCTTTGTAGTGTCTACCATGCGATCCTGAGCAATTGAGAAATGGAACAATCTTGACTCAAGTCACCCTAACTTTTCATGAAGAACAACTTGGGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 16.60% 12.04% 31.19% NA
All Indica  2759 11.80% 21.10% 17.25% 49.87% NA
All Japonica  1512 95.80% 2.90% 0.79% 0.53% NA
Aus  269 11.50% 39.40% 27.88% 21.19% NA
Indica I  595 20.50% 35.30% 13.61% 30.59% NA
Indica II  465 14.80% 12.00% 13.76% 59.35% NA
Indica III  913 2.50% 11.70% 21.47% 64.29% NA
Indica Intermediate  786 14.10% 26.60% 17.18% 42.11% NA
Temperate Japonica  767 92.80% 5.30% 1.30% 0.52% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 45.80% 41.70% 1.04% 11.46% NA
Intermediate  90 56.70% 13.30% 5.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714860463 G -> DEL N N silent_mutation Average:11.926; most accessible tissue: Callus, score: 30.392 N N N N
vg0714860463 G -> C LOC_Os07g25880.1 upstream_gene_variant ; 1982.0bp to feature; MODIFIER silent_mutation Average:11.926; most accessible tissue: Callus, score: 30.392 N N N N
vg0714860463 G -> C LOC_Os07g25860.1 downstream_gene_variant ; 3284.0bp to feature; MODIFIER silent_mutation Average:11.926; most accessible tissue: Callus, score: 30.392 N N N N
vg0714860463 G -> C LOC_Os07g25870.1 downstream_gene_variant ; 1526.0bp to feature; MODIFIER silent_mutation Average:11.926; most accessible tissue: Callus, score: 30.392 N N N N
vg0714860463 G -> C LOC_Os07g25870-LOC_Os07g25880 intergenic_region ; MODIFIER silent_mutation Average:11.926; most accessible tissue: Callus, score: 30.392 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714860463 NA 3.83E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.71E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 6.61E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.45E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.20E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.04E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.90E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 8.15E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.67E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 2.12E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 2.72E-09 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 9.70E-06 9.70E-06 mr1004_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 3.26E-83 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.20E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 4.48E-08 NA mr1265_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 2.54E-06 2.54E-06 mr1265_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 8.10E-06 NA mr1444_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 1.99E-08 NA mr1528_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 7.79E-08 7.79E-08 mr1528_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.11E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463 NA 1.71E-32 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251