Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714860463:

Variant ID: vg0714860463 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14860463
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCCAAGTTGTTCTTCATGAAAAGTTAGGGTGACTTGAGTCAAGATTGTTCCATTTCTCAATTGCTCAGGATCGCATGGTAGACACTACAAAGACCCA[G/C]
AAGTACAGGTATGGCTTTGAATAATTTGTTTGCATGATTATTAATAAGGAAGTCATAACTTTGTTGTAGAGTCCATAGCCTTCACTCGAGACGAGCAAAG

Reverse complement sequence

CTTTGCTCGTCTCGAGTGAAGGCTATGGACTCTACAACAAAGTTATGACTTCCTTATTAATAATCATGCAAACAAATTATTCAAAGCCATACCTGTACTT[C/G]
TGGGTCTTTGTAGTGTCTACCATGCGATCCTGAGCAATTGAGAAATGGAACAATCTTGACTCAAGTCACCCTAACTTTTCATGAAGAACAACTTGGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.20%	16.60%	12.04%	31.19%	NA
All Indica	2759	11.80%	21.10%	17.25%	49.87%	NA
All Japonica	1512	95.80%	2.90%	0.79%	0.53%	NA
Aus	269	11.50%	39.40%	27.88%	21.19%	NA
Indica I	595	20.50%	35.30%	13.61%	30.59%	NA
Indica II	465	14.80%	12.00%	13.76%	59.35%	NA
Indica III	913	2.50%	11.70%	21.47%	64.29%	NA
Indica Intermediate	786	14.10%	26.60%	17.18%	42.11%	NA
Temperate Japonica	767	92.80%	5.30%	1.30%	0.52%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	97.50%	1.20%	0.00%	1.24%	NA
VI/Aromatic	96	45.80%	41.70%	1.04%	11.46%	NA
Intermediate	90	56.70%	13.30%	5.56%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714860463	G -> DEL	N	N	silent_mutation	Average:11.926; most accessible tissue: Callus, score: 30.392	N	N	N	N
vg0714860463	G -> C	LOC_Os07g25880.1	upstream_gene_variant ; 1982.0bp to feature; MODIFIER	silent_mutation	Average:11.926; most accessible tissue: Callus, score: 30.392	N	N	N	N
vg0714860463	G -> C	LOC_Os07g25860.1	downstream_gene_variant ; 3284.0bp to feature; MODIFIER	silent_mutation	Average:11.926; most accessible tissue: Callus, score: 30.392	N	N	N	N
vg0714860463	G -> C	LOC_Os07g25870.1	downstream_gene_variant ; 1526.0bp to feature; MODIFIER	silent_mutation	Average:11.926; most accessible tissue: Callus, score: 30.392	N	N	N	N
vg0714860463	G -> C	LOC_Os07g25870-LOC_Os07g25880	intergenic_region ; MODIFIER	silent_mutation	Average:11.926; most accessible tissue: Callus, score: 30.392	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714860463	NA	3.83E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.71E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	6.61E-86	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.45E-69	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.20E-44	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.04E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.90E-57	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	8.15E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.67E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	2.12E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	2.72E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	9.70E-06	9.70E-06	mr1004_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	3.26E-83	mr1027_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.20E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	4.48E-08	NA	mr1265_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	2.54E-06	2.54E-06	mr1265_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	8.10E-06	NA	mr1444_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	1.99E-08	NA	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	7.79E-08	7.79E-08	mr1528_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.11E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714860463	NA	1.71E-32	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251