Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714760963:

Variant ID: vg0714760963 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14760963
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGCATATTATAGCTAACGCAACATCTTATTTATGTGATTGTGGCCGACTGAGATGGAATTTGAAGATGAAGCTGGATCCGTTGAAAAGAGGACTCAGA[A/G]
AGTTTTCCATCAAGTACTCATGGGCAAAAAATGGAGATCGTATGCACATTTGGCGGCCATTTGAAGTCAATATTGTTGCAGGTCACCGAATTGGATTCCA

Reverse complement sequence

TGGAATCCAATTCGGTGACCTGCAACAATATTGACTTCAAATGGCCGCCAAATGTGCATACGATCTCCATTTTTTGCCCATGAGTACTTGATGGAAAACT[T/C]
TCTGAGTCCTCTTTTCAACGGATCCAGCTTCATCTTCAAATTCCATCTCAGTCGGCCACAATCACATAAATAAGATGTTGCGTTAGCTATAATATGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.10%	0.11%	0.19%	NA
All Indica	2759	96.50%	3.20%	0.11%	0.18%	NA
All Japonica	1512	1.50%	98.40%	0.00%	0.07%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	92.90%	6.70%	0.17%	0.17%	NA
Indica II	465	96.60%	3.20%	0.00%	0.22%	NA
Indica III	913	99.30%	0.30%	0.11%	0.22%	NA
Indica Intermediate	786	95.90%	3.80%	0.13%	0.13%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.10%	0.00%	0.41%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	52.20%	43.30%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714760963	A -> DEL	N	N	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N
vg0714760963	A -> G	LOC_Os07g25730.1	upstream_gene_variant ; 3085.0bp to feature; MODIFIER	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N
vg0714760963	A -> G	LOC_Os07g25710.1	downstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N
vg0714760963	A -> G	LOC_Os07g25710.2	downstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N
vg0714760963	A -> G	LOC_Os07g25710.3	downstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N
vg0714760963	A -> G	LOC_Os07g25710.4	downstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N
vg0714760963	A -> G	LOC_Os07g25710-LOC_Os07g25730	intergenic_region ; MODIFIER	silent_mutation	Average:61.871; most accessible tissue: Callus, score: 87.438	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714760963	NA	9.87E-69	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	1.96E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	9.56E-44	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	1.97E-49	mr1154	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	7.10E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	7.70E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	6.43E-58	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	7.67E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	1.18E-43	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	5.48E-37	mr1647	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	2.25E-38	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	1.72E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	1.35E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	1.40E-20	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	6.60E-40	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	3.18E-12	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	2.84E-17	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	9.50E-19	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714760963	NA	2.25E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251