\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714713139:

Variant ID: vg0714713139 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14713139
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCACATTCATATTGATGTTAATGAATCTAGACATAGTTATCTATCTAGATTCATTAACATCAATATGAATGTGAGAAATGTTAGAATGACTTACATT[G/A]
TGAAACGGAGGAAGTAGTAAAGTAGTTGTCTGGATGTTTTGTGTTATTCCTTGAAGTATGCAACTGAAAGGGGATCCAATGTGTTCCACGTTATCATAAT

Reverse complement sequence

ATTATGATAACGTGGAACACATTGGATCCCCTTTCAGTTGCATACTTCAAGGAATAACACAAAACATCCAGACAACTACTTTACTACTTCCTCCGTTTCA[C/T]
AATGTAAGTCATTCTAACATTTCTCACATTCATATTGATGTTAATGAATCTAGATAGATAACTATGTCTAGATTCATTAACATCAATATGAATGTGGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.70% 0.02% 0.00% NA
All Indica  2759 93.20% 6.70% 0.04% 0.00% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 75.50% 24.50% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 95.70% 4.10% 0.22% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.90% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714713139 G -> A LOC_Os07g25650.1 upstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:28.282; most accessible tissue: Callus, score: 51.209 N N N N
vg0714713139 G -> A LOC_Os07g25660.1 intron_variant ; MODIFIER silent_mutation Average:28.282; most accessible tissue: Callus, score: 51.209 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714713139 NA 7.04E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 3.78E-06 3.78E-06 mr1398 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 NA 1.22E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 NA 3.52E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 NA 2.27E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 NA 4.87E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 NA 2.99E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714713139 NA 1.40E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251