\
| Variant ID: vg0714713139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14713139 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 99. )
TTCCCACATTCATATTGATGTTAATGAATCTAGACATAGTTATCTATCTAGATTCATTAACATCAATATGAATGTGAGAAATGTTAGAATGACTTACATT[G/A]
TGAAACGGAGGAAGTAGTAAAGTAGTTGTCTGGATGTTTTGTGTTATTCCTTGAAGTATGCAACTGAAAGGGGATCCAATGTGTTCCACGTTATCATAAT
ATTATGATAACGTGGAACACATTGGATCCCCTTTCAGTTGCATACTTCAAGGAATAACACAAAACATCCAGACAACTACTTTACTACTTCCTCCGTTTCA[C/T]
AATGTAAGTCATTCTAACATTTCTCACATTCATATTGATGTTAATGAATCTAGATAGATAACTATGTCTAGATTCATTAACATCAATATGAATGTGGGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 39.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.20% | 6.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714713139 | G -> A | LOC_Os07g25650.1 | upstream_gene_variant ; 4251.0bp to feature; MODIFIER | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 51.209 | N | N | N | N |
| vg0714713139 | G -> A | LOC_Os07g25660.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 51.209 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714713139 | NA | 7.04E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | 3.78E-06 | 3.78E-06 | mr1398 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | NA | 1.22E-15 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | NA | 3.52E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | NA | 2.27E-24 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | NA | 4.87E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | NA | 2.99E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714713139 | NA | 1.40E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |