Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0714702171:

Variant ID: vg0714702171 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14702171
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGATCAAAAGCGAAATCGCCTGGGGATCGCTTTTGCGTCGGAGGAATCGCCGGAGAGAGAAGGGACAAAGTTTCGCTTGGGCGGTGAAAACGGAAGTCA[C/T]
GGCGTGAGATTTTTTTGAGGGCAACGGTTGGTATTTAAAGCGATAGAATAACGGTCAGAAAATGGCAGAGTGCGAAACTTGCTCGGAGTCGGTACACGGC

Reverse complement sequence

GCCGTGTACCGACTCCGAGCAAGTTTCGCACTCTGCCATTTTCTGACCGTTATTCTATCGCTTTAAATACCAACCGTTGCCCTCAAAAAAATCTCACGCC[G/A]
TGACTTCCGTTTTCACCGCCCAAGCGAAACTTTGTCCCTTCTCTCTCCGGCGATTCCTCCGACGCAAAAGCGATCCCCAGGCGATTTCGCTTTTGATCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.60%	2.60%	2.73%	54.06%	NA
All Indica	2759	7.80%	4.10%	3.73%	84.34%	NA
All Japonica	1512	99.10%	0.10%	0.07%	0.73%	NA
Aus	269	27.90%	3.00%	7.81%	61.34%	NA
Indica I	595	8.60%	3.70%	1.18%	86.55%	NA
Indica II	465	5.60%	2.60%	1.72%	90.11%	NA
Indica III	913	2.20%	5.00%	6.24%	86.53%	NA
Indica Intermediate	786	15.10%	4.20%	3.94%	76.72%	NA
Temperate Japonica	767	99.10%	0.10%	0.00%	0.78%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	85.40%	0.00%	1.04%	13.54%	NA
Intermediate	90	53.30%	0.00%	3.33%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714702171	C -> DEL	N	N	silent_mutation	Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0714702171	C -> T	LOC_Os07g25640.1	upstream_gene_variant ; 117.0bp to feature; MODIFIER	silent_mutation	Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0714702171	C -> T	LOC_Os07g25630.1	downstream_gene_variant ; 3781.0bp to feature; MODIFIER	silent_mutation	Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0714702171	C -> T	LOC_Os07g25650.1	downstream_gene_variant ; 340.0bp to feature; MODIFIER	silent_mutation	Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0714702171	C -> T	LOC_Os07g25640-LOC_Os07g25650	intergenic_region ; MODIFIER	silent_mutation	Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714702171	NA	6.35E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	2.77E-26	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	1.27E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	1.24E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	2.70E-06	NA	mr1904	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	8.02E-07	5.10E-07	mr1904	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	1.11E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	8.36E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	4.98E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	4.25E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	4.03E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	1.34E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	4.32E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	3.82E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171	NA	1.00E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251