\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714702171:

Variant ID: vg0714702171 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14702171
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGATCAAAAGCGAAATCGCCTGGGGATCGCTTTTGCGTCGGAGGAATCGCCGGAGAGAGAAGGGACAAAGTTTCGCTTGGGCGGTGAAAACGGAAGTCA[C/T]
GGCGTGAGATTTTTTTGAGGGCAACGGTTGGTATTTAAAGCGATAGAATAACGGTCAGAAAATGGCAGAGTGCGAAACTTGCTCGGAGTCGGTACACGGC

Reverse complement sequence

GCCGTGTACCGACTCCGAGCAAGTTTCGCACTCTGCCATTTTCTGACCGTTATTCTATCGCTTTAAATACCAACCGTTGCCCTCAAAAAAATCTCACGCC[G/A]
TGACTTCCGTTTTCACCGCCCAAGCGAAACTTTGTCCCTTCTCTCTCCGGCGATTCCTCCGACGCAAAAGCGATCCCCAGGCGATTTCGCTTTTGATCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 2.60% 2.73% 54.06% NA
All Indica  2759 7.80% 4.10% 3.73% 84.34% NA
All Japonica  1512 99.10% 0.10% 0.07% 0.73% NA
Aus  269 27.90% 3.00% 7.81% 61.34% NA
Indica I  595 8.60% 3.70% 1.18% 86.55% NA
Indica II  465 5.60% 2.60% 1.72% 90.11% NA
Indica III  913 2.20% 5.00% 6.24% 86.53% NA
Indica Intermediate  786 15.10% 4.20% 3.94% 76.72% NA
Temperate Japonica  767 99.10% 0.10% 0.00% 0.78% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 85.40% 0.00% 1.04% 13.54% NA
Intermediate  90 53.30% 0.00% 3.33% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714702171 C -> DEL N N silent_mutation Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0714702171 C -> T LOC_Os07g25640.1 upstream_gene_variant ; 117.0bp to feature; MODIFIER silent_mutation Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0714702171 C -> T LOC_Os07g25630.1 downstream_gene_variant ; 3781.0bp to feature; MODIFIER silent_mutation Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0714702171 C -> T LOC_Os07g25650.1 downstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0714702171 C -> T LOC_Os07g25640-LOC_Os07g25650 intergenic_region ; MODIFIER silent_mutation Average:11.63; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714702171 NA 6.35E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 2.77E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 1.27E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 1.24E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 2.70E-06 NA mr1904 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 8.02E-07 5.10E-07 mr1904 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 1.11E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 8.36E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 4.98E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 4.25E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 4.03E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 1.34E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 4.32E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 3.82E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714702171 NA 1.00E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251