\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714688578:

Variant ID: vg0714688578 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14688578
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGCCAGGGAGCCTTGGGGTGCCACGTCACACCCCTCGGGCTTTCGGGGCGGGCTACCCCGAGGCCCTCGCCCAGCCACCACGTGGCGGGGAGAGCGG[G/A]
CGGGGCGGAGGGCGCCTCTCAGGGCCTTTAATGGGCGGCCCCCCCAACCGTCCCTCACTTCATTTAATGCGGTGTGGGTGGACATGCGGCGCCAATCGGG

Reverse complement sequence

CCCGATTGGCGCCGCATGTCCACCCACACCGCATTAAATGAAGTGAGGGACGGTTGGGGGGGCCGCCCATTAAAGGCCCTGAGAGGCGCCCTCCGCCCCG[C/T]
CCGCTCTCCCCGCCACGTGGTGGCTGGGCGAGGGCCTCGGGGTAGCCCGCCCCGAAAGCCCGAGGGGTGTGACGTGGCACCCCAAGGCTCCCTGGCCACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 41.20% 2.52% 5.63% NA
All Indica  2759 78.80% 9.00% 3.91% 8.34% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 60.20% 26.80% 2.60% 10.41% NA
Indica I  595 75.10% 9.10% 8.24% 7.56% NA
Indica II  465 88.00% 4.70% 1.94% 5.38% NA
Indica III  913 81.10% 4.10% 2.85% 12.05% NA
Indica Intermediate  786 73.50% 17.00% 3.05% 6.36% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 87.50% 1.04% 5.21% NA
Intermediate  90 43.30% 50.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714688578 G -> DEL N N silent_mutation Average:79.892; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0714688578 G -> A LOC_Os07g25620.1 upstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:79.892; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0714688578 G -> A LOC_Os07g25630.1 upstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:79.892; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0714688578 G -> A LOC_Os07g25620-LOC_Os07g25630 intergenic_region ; MODIFIER silent_mutation Average:79.892; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0714688578 G A -0.02 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714688578 NA 4.02E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 7.41E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 4.62E-06 NA mr1860 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 8.38E-07 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 1.91E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 9.70E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 9.06E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 1.27E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714688578 NA 2.65E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251