\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714560467:

Variant ID: vg0714560467 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14560467
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTTTGAAATGAGATTGGATATTGCTACTCTATCATTTACTGTGAGCATGCTTCCCAAACGACGTGTTTTTGCAAGTAAAATATATAAGTTTCTTTTT[T/A]
AAAAAATAAACTCAAGTTTTTAATAATAACTATAATTATTGTTTCAATTAATTATATACTAATGGCTAACTTCTCTTTTAAACTCAGCCTAAGTCGATTT

Reverse complement sequence

AAATCGACTTAGGCTGAGTTTAAAAGAGAAGTTAGCCATTAGTATATAATTAATTGAAACAATAATTATAGTTATTATTAAAAACTTGAGTTTATTTTTT[A/T]
AAAAAGAAACTTATATATTTTACTTGCAAAAACACGTCGTTTGGGAAGCATGCTCACAGTAAATGATAGAGTAGCAATATCCAATCTCATTTCAAAATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.90% 0.04% 0.00% NA
All Indica  2759 96.90% 3.00% 0.07% 0.00% NA
All Japonica  1512 78.60% 21.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.30% 0.13% 0.00% NA
Temperate Japonica  767 65.20% 34.80% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 15.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714560467 T -> A LOC_Os07g25450.1 upstream_gene_variant ; 2794.0bp to feature; MODIFIER silent_mutation Average:37.557; most accessible tissue: Callus, score: 59.499 N N N N
vg0714560467 T -> A LOC_Os07g25440-LOC_Os07g25450 intergenic_region ; MODIFIER silent_mutation Average:37.557; most accessible tissue: Callus, score: 59.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714560467 NA 3.16E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 2.14E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 6.85E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 1.38E-09 mr1624_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 2.60E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 7.96E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 3.53E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 8.49E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714560467 NA 2.37E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251