\
| Variant ID: vg0714560467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14560467 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTTTGAAATGAGATTGGATATTGCTACTCTATCATTTACTGTGAGCATGCTTCCCAAACGACGTGTTTTTGCAAGTAAAATATATAAGTTTCTTTTT[T/A]
AAAAAATAAACTCAAGTTTTTAATAATAACTATAATTATTGTTTCAATTAATTATATACTAATGGCTAACTTCTCTTTTAAACTCAGCCTAAGTCGATTT
AAATCGACTTAGGCTGAGTTTAAAAGAGAAGTTAGCCATTAGTATATAATTAATTGAAACAATAATTATAGTTATTATTAAAAACTTGAGTTTATTTTTT[A/T]
AAAAAGAAACTTATATATTTTACTTGCAAAAACACGTCGTTTGGGAAGCATGCTCACAGTAAATGATAGAGTAGCAATATCCAATCTCATTTCAAAATTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 65.20% | 34.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714560467 | T -> A | LOC_Os07g25450.1 | upstream_gene_variant ; 2794.0bp to feature; MODIFIER | silent_mutation | Average:37.557; most accessible tissue: Callus, score: 59.499 | N | N | N | N |
| vg0714560467 | T -> A | LOC_Os07g25440-LOC_Os07g25450 | intergenic_region ; MODIFIER | silent_mutation | Average:37.557; most accessible tissue: Callus, score: 59.499 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714560467 | NA | 3.16E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 2.14E-09 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 6.85E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 1.38E-09 | mr1624_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 2.60E-08 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 7.96E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 3.53E-07 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 8.49E-06 | mr1751_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714560467 | NA | 2.37E-06 | mr1887_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |