\
| Variant ID: vg0714532415 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14532415 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCCATTCTATTTTACAAATTAACGATACTCTCGTGAGTTTAGAAGCCTATTTTCGTTTCTATATTCGTGTCGGATCATTTTCAAAAATACAAGATAATT[C/T]
GTATTTACTTTTAAACGAGCTATTCATATTTACTTTCATAAAATAAACTAAAAGACGAATATGATACAAACATTGTTATCTGTCCATATACACTTTGTTT
AAACAAAGTGTATATGGACAGATAACAATGTTTGTATCATATTCGTCTTTTAGTTTATTTTATGAAAGTAAATATGAATAGCTCGTTTAAAAGTAAATAC[G/A]
AATTATCTTGTATTTTTGAAAATGATCCGACACGAATATAGAAACGAAAATAGGCTTCTAAACTCACGAGAGTATCGTTAATTTGTAAAATAGAATGGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 2.90% | 3.66% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 4.80% | 6.16% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 0.00% | 2.35% | 0.00% | NA |
| Indica II | 465 | 75.30% | 9.20% | 15.48% | 0.00% | NA |
| Indica III | 913 | 89.40% | 5.90% | 4.71% | 0.00% | NA |
| Indica Intermediate | 786 | 90.30% | 4.50% | 5.22% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714532415 | C -> T | LOC_Os07g25420.1 | upstream_gene_variant ; 1892.0bp to feature; MODIFIER | silent_mutation | Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0714532415 | C -> T | LOC_Os07g25430.1 | upstream_gene_variant ; 889.0bp to feature; MODIFIER | silent_mutation | Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0714532415 | C -> T | LOC_Os07g25420.2 | upstream_gene_variant ; 1892.0bp to feature; MODIFIER | silent_mutation | Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0714532415 | C -> T | LOC_Os07g25440.1 | downstream_gene_variant ; 2063.0bp to feature; MODIFIER | silent_mutation | Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0714532415 | C -> T | LOC_Os07g25440.2 | downstream_gene_variant ; 2063.0bp to feature; MODIFIER | silent_mutation | Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg0714532415 | C -> T | LOC_Os07g25420-LOC_Os07g25430 | intergenic_region ; MODIFIER | silent_mutation | Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714532415 | NA | 1.32E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714532415 | 1.15E-06 | 1.15E-06 | mr1562 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |