\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714532415:

Variant ID: vg0714532415 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14532415
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCATTCTATTTTACAAATTAACGATACTCTCGTGAGTTTAGAAGCCTATTTTCGTTTCTATATTCGTGTCGGATCATTTTCAAAAATACAAGATAATT[C/T]
GTATTTACTTTTAAACGAGCTATTCATATTTACTTTCATAAAATAAACTAAAAGACGAATATGATACAAACATTGTTATCTGTCCATATACACTTTGTTT

Reverse complement sequence

AAACAAAGTGTATATGGACAGATAACAATGTTTGTATCATATTCGTCTTTTAGTTTATTTTATGAAAGTAAATATGAATAGCTCGTTTAAAAGTAAATAC[G/A]
AATTATCTTGTATTTTTGAAAATGATCCGACACGAATATAGAAACGAAAATAGGCTTCTAAACTCACGAGAGTATCGTTAATTTGTAAAATAGAATGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 2.90% 3.66% 0.00% NA
All Indica  2759 89.10% 4.80% 6.16% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 0.00% 2.35% 0.00% NA
Indica II  465 75.30% 9.20% 15.48% 0.00% NA
Indica III  913 89.40% 5.90% 4.71% 0.00% NA
Indica Intermediate  786 90.30% 4.50% 5.22% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714532415 C -> T LOC_Os07g25420.1 upstream_gene_variant ; 1892.0bp to feature; MODIFIER silent_mutation Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0714532415 C -> T LOC_Os07g25430.1 upstream_gene_variant ; 889.0bp to feature; MODIFIER silent_mutation Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0714532415 C -> T LOC_Os07g25420.2 upstream_gene_variant ; 1892.0bp to feature; MODIFIER silent_mutation Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0714532415 C -> T LOC_Os07g25440.1 downstream_gene_variant ; 2063.0bp to feature; MODIFIER silent_mutation Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0714532415 C -> T LOC_Os07g25440.2 downstream_gene_variant ; 2063.0bp to feature; MODIFIER silent_mutation Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0714532415 C -> T LOC_Os07g25420-LOC_Os07g25430 intergenic_region ; MODIFIER silent_mutation Average:45.095; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714532415 NA 1.32E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714532415 1.15E-06 1.15E-06 mr1562 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251