RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0714477799:

Variant ID: vg0714477799 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14477799
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCCTGTAGTGCAACGATTTCCTGATGTGTTTCCAGAAGATTTACCTGGGATGCCACCCGATCGGGACATAGAGTTCATCATTGACCTGATACCAGGAA[C/T]
TGCACCCATATCCAAGAAACCGTATCGGGTGCCAGTCAATGAGTTGGAGGAACTTAAGAAGCAAATCAGAGAGTTGCAAGAAAAAGGGTTTGTACGCCCC

Reverse complement sequence

GGGGCGTACAAACCCTTTTTCTTGCAACTCTCTGATTTGCTTCTTAAGTTCCTCCAACTCATTGACTGGCACCCGATACGGTTTCTTGGATATGGGTGCA[G/A]
TTCCTGGTATCAGGTCAATGATGAACTCTATGTCCCGATCGGGTGGCATCCCAGGTAAATCTTCTGGAAACACATCAGGAAATCGTTGCACTACAGGCAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.40%	3.00%	12.80%	42.76%	NA
All Indica	2759	17.80%	5.10%	20.26%	56.87%	NA
All Japonica	1512	84.40%	0.10%	1.85%	13.69%	NA
Aus	269	22.70%	0.00%	0.74%	76.58%	NA
Indica I	595	34.30%	11.10%	40.67%	13.95%	NA
Indica II	465	21.30%	2.80%	14.84%	61.08%	NA
Indica III	913	2.30%	3.60%	10.51%	83.57%	NA
Indica Intermediate	786	21.10%	3.70%	19.34%	55.85%	NA
Temperate Japonica	767	85.80%	0.10%	1.04%	13.04%	NA
Tropical Japonica	504	94.40%	0.00%	0.60%	4.96%	NA
Japonica Intermediate	241	58.90%	0.00%	7.05%	34.02%	NA
VI/Aromatic	96	81.20%	0.00%	8.33%	10.42%	NA
Intermediate	90	57.80%	1.10%	8.89%	32.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714477799	C -> DEL	LOC_Os07g25340.1	N	frameshift_variant	Average:28.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0714477799	C -> T	LOC_Os07g25340.1	missense_variant ; p.Thr496Ile; MODERATE	nonsynonymous_codon ; T496I	Average:28.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	benign	0.932	DELETERIOUS	0.00

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714477799	NA	2.76E-16	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	NA	2.08E-16	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	2.24E-06	8.28E-18	mr1118	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	7.06E-06	1.35E-15	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	NA	3.15E-19	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	NA	3.95E-08	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	NA	1.54E-10	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	1.72E-06	1.72E-06	mr1842	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	NA	7.56E-20	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714477799	NA	1.34E-21	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 20 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0714477799:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact