\
| Variant ID: vg0714477068 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14477068 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )
GCAACTTCAACAGGCCGGTTGCAATTCAGAACCGCACTCCTACACCAACTATGGCTGCCCCTGAAGCCAAGAAGAATGTGGACTACTTCAACTGCGGGGA[G/A]
TACAGGCACTACGCCAACAACTGCCCTCATCCACGCAAAACTCCTGTCCGTACTGGCGCAAATGCAATGACTGTTCGTGGTACTGCTACCCCTGCTGCCG
CGGCAGCAGGGGTAGCAGTACCACGAACAGTCATTGCATTTGCGCCAGTACGGACAGGAGTTTTGCGTGGATGAGGGCAGTTGTTGGCGTAGTGCCTGTA[C/T]
TCCCCGCAGTTGAAGTAGTCCACATTCTTCTTGGCTTCAGGGGCAGCCATAGTTGGTGTAGGAGTGCGGTTCTGAATTGCAACCGGCCTGTTGAAGTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 12.10% | 10.45% | 15.62% | NA |
| All Indica | 2759 | 48.60% | 18.40% | 14.24% | 18.77% | NA |
| All Japonica | 1512 | 83.10% | 3.40% | 2.25% | 11.24% | NA |
| Aus | 269 | 66.50% | 3.00% | 14.13% | 16.36% | NA |
| Indica I | 595 | 41.80% | 44.00% | 12.77% | 1.34% | NA |
| Indica II | 465 | 63.90% | 9.20% | 11.61% | 15.27% | NA |
| Indica III | 913 | 39.10% | 9.40% | 15.88% | 35.60% | NA |
| Indica Intermediate | 786 | 55.70% | 14.80% | 15.01% | 14.50% | NA |
| Temperate Japonica | 767 | 82.10% | 5.30% | 0.78% | 11.73% | NA |
| Tropical Japonica | 504 | 94.00% | 2.00% | 0.60% | 3.37% | NA |
| Japonica Intermediate | 241 | 63.10% | 0.40% | 10.37% | 26.14% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 19.79% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 4.40% | 11.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714477068 | G -> DEL | LOC_Os07g25340.1 | N | frameshift_variant | Average:20.723; most accessible tissue: Callus, score: 61.803 | N | N | N | N |
| vg0714477068 | G -> A | LOC_Os07g25340.1 | synonymous_variant ; p.Glu354Glu; LOW | synonymous_codon | Average:20.723; most accessible tissue: Callus, score: 61.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714477068 | NA | 3.40E-14 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 1.14E-16 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 1.09E-13 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 8.83E-07 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 2.76E-19 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 1.24E-08 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 5.52E-09 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 2.41E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 3.08E-17 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 8.50E-23 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 2.46E-08 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 2.06E-10 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 7.01E-08 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 9.99E-23 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 3.47E-22 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 1.77E-10 | mr1496_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 1.77E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714477068 | NA | 4.68E-09 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |