\
| Variant ID: vg0714475265 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14475265 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAGAGGAGGATGCCGGCCTGAGGTTAGGGAAGGGTCCGACATGTGGGGCCCACATGTCGGTCTCCAGAGTGGAGGGGCGGCTGGCGGGCTGGCTGGGCC[G/A]
GCTTGGCCACGGGTGAGAGAGGGAGAGTTGGGCCAAAAACGGCCCAACAACTTAAGGAGGGGTTTTTGGAACTTTTCAACTAAAATAATTTGTGAAATGT
ACATTTCACAAATTATTTTAGTTGAAAAGTTCCAAAAACCCCTCCTTAAGTTGTTGGGCCGTTTTTGGCCCAACTCTCCCTCTCTCACCCGTGGCCAAGC[C/T]
GGCCCAGCCAGCCCGCCAGCCGCCCCTCCACTCTGGAGACCGACATGTGGGCCCCACATGTCGGACCCTTCCCTAACCTCAGGCCGGCATCCTCCTCTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.30% | 6.50% | 11.02% | 6.20% | NA |
| All Indica | 2759 | 68.50% | 11.00% | 16.27% | 4.24% | NA |
| All Japonica | 1512 | 84.50% | 0.20% | 3.77% | 11.51% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 94.30% | 2.40% | 3.36% | 0.00% | NA |
| Indica II | 465 | 56.10% | 11.00% | 24.30% | 8.60% | NA |
| Indica III | 913 | 57.50% | 16.40% | 21.03% | 5.04% | NA |
| Indica Intermediate | 786 | 69.10% | 11.20% | 15.78% | 3.94% | NA |
| Temperate Japonica | 767 | 82.10% | 0.30% | 3.52% | 14.08% | NA |
| Tropical Japonica | 504 | 95.20% | 0.00% | 1.79% | 2.98% | NA |
| Japonica Intermediate | 241 | 69.70% | 0.40% | 8.71% | 21.16% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 2.20% | 12.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714475265 | G -> DEL | LOC_Os07g25340.1 | N | frameshift_variant | Average:19.91; most accessible tissue: Callus, score: 40.044 | N | N | N | N |
| vg0714475265 | G -> A | LOC_Os07g25340.1 | synonymous_variant ; p.Pro20Pro; LOW | synonymous_codon | Average:19.91; most accessible tissue: Callus, score: 40.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714475265 | 1.11E-06 | 1.11E-06 | mr1313 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 3.51E-06 | 3.51E-06 | mr1473 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 2.08E-06 | 2.08E-06 | mr1664 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 9.45E-08 | 9.45E-08 | mr1848 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 4.86E-06 | 4.86E-06 | mr1279_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 5.54E-06 | 5.54E-06 | mr1313_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 2.53E-07 | 2.53E-07 | mr1473_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 3.06E-07 | 3.06E-07 | mr1630_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714475265 | 1.82E-09 | 1.82E-09 | mr1848_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |