\
| Variant ID: vg0714473083 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14473083 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAACAAATTGATAATAGAGTACAAATAAATAACTATTTAATATTCGCAAATAATAAATTATTACAGAGGTAGATAGTTCCTCTGAAAGAATAACATACTA[C/T]
GCAGCGGAAAATAAAACTAAAGCAAACTACGGAACAGCTATGGCGACTCCACTCCACAGGCATCTTAACCAAGAACAAGCTTAATCCTCCAGGACATCAC
GTGATGTCCTGGAGGATTAAGCTTGTTCTTGGTTAAGATGCCTGTGGAGTGGAGTCGCCATAGCTGTTCCGTAGTTTGCTTTAGTTTTATTTTCCGCTGC[G/A]
TAGTATGTTATTCTTTCAGAGGAACTATCTACCTCTGTAATAATTTATTATTTGCGAATATTAAATAGTTATTTATTTGTACTCTATTATCAATTTGTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 1.50% | 5.69% | 2.35% | NA |
| All Indica | 2759 | 88.80% | 2.50% | 7.50% | 1.27% | NA |
| All Japonica | 1512 | 91.50% | 0.00% | 3.84% | 4.63% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 84.40% | 3.70% | 11.93% | 0.00% | NA |
| Indica II | 465 | 87.30% | 1.70% | 5.16% | 5.81% | NA |
| Indica III | 913 | 91.70% | 2.00% | 5.59% | 0.77% | NA |
| Indica Intermediate | 786 | 89.60% | 2.50% | 7.76% | 0.13% | NA |
| Temperate Japonica | 767 | 91.00% | 0.00% | 4.69% | 4.30% | NA |
| Tropical Japonica | 504 | 95.80% | 0.00% | 1.39% | 2.78% | NA |
| Japonica Intermediate | 241 | 84.20% | 0.00% | 6.22% | 9.54% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714473083 | C -> DEL | N | N | silent_mutation | Average:20.016; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0714473083 | C -> T | LOC_Os07g25330.1 | upstream_gene_variant ; 786.0bp to feature; MODIFIER | silent_mutation | Average:20.016; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0714473083 | C -> T | LOC_Os07g25340.1 | upstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:20.016; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0714473083 | C -> T | LOC_Os07g25330-LOC_Os07g25340 | intergenic_region ; MODIFIER | silent_mutation | Average:20.016; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714473083 | 7.80E-07 | 1.84E-10 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714473083 | NA | 1.23E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714473083 | NA | 6.18E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714473083 | NA | 4.42E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714473083 | NA | 7.37E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |