Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714470576:

Variant ID: vg0714470576 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14470576
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATTGCGGTTGTCATTGGTGCGGTTACCAGTATTGTTGTGGTAGAACTGGCGTTGAGGGCGGACAACTAATGAAGATCCTCCTTGAGGGTACGATGGA[G/A]
CTTGAGGTCCCGTAACGAGACGCGGCCTCTGGTTACTGCCCTGTTGAGCCTTAAATTGGGCAGCCCTGCGCTTCTTCTGCTCCATTCGATTATACTTGTC

Reverse complement sequence

GACAAGTATAATCGAATGGAGCAGAAGAAGCGCAGGGCTGCCCAATTTAAGGCTCAACAGGGCAGTAACCAGAGGCCGCGTCTCGTTACGGGACCTCAAG[C/T]
TCCATCGTACCCTCAAGGAGGATCTTCATTAGTTGTCCGCCCTCAACGCCAGTTCTACCACAACAATACTGGTAACCGCACCAATGACAACCGCAATATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	5.70%	1.02%	5.84%	NA
All Indica	2759	84.50%	8.80%	1.34%	5.33%	NA
All Japonica	1512	91.00%	0.50%	0.46%	8.00%	NA
Aus	269	91.80%	5.60%	1.12%	1.49%	NA
Indica I	595	72.90%	17.60%	2.02%	7.39%	NA
Indica II	465	86.70%	5.80%	2.15%	5.38%	NA
Indica III	913	88.50%	6.00%	0.44%	5.04%	NA
Indica Intermediate	786	87.30%	7.30%	1.40%	4.07%	NA
Temperate Japonica	767	89.40%	0.90%	0.39%	9.26%	NA
Tropical Japonica	504	97.40%	0.00%	0.20%	2.38%	NA
Japonica Intermediate	241	82.60%	0.40%	1.24%	15.77%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	1.10%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714470576	G -> DEL	LOC_Os07g25330.1	N	frameshift_variant	Average:23.604; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0714470576	G -> A	LOC_Os07g25330.1	missense_variant ; p.Ala53Val; MODERATE	nonsynonymous_codon ; A53V	Average:23.604; most accessible tissue: Zhenshan97 young leaf, score: 47.311	benign	0.123	TOLERATED	0.16

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714470576	4.92E-08	4.92E-08	mr1341_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	4.23E-06	4.23E-06	mr1523_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	1.39E-06	1.39E-06	mr1529_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	NA	2.82E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	9.32E-06	9.32E-06	mr1569_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	3.54E-06	NA	mr1636_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	5.90E-06	6.93E-06	mr1748_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	4.69E-06	4.69E-06	mr1753_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	7.31E-06	NA	mr1767_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	6.95E-06	NA	mr1921_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	NA	5.10E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714470576	NA	9.57E-06	mr1985_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251