\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714344926:

Variant ID: vg0714344926 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14344926
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCAGCAAACTCCCGCCAAGTGATAGGCTGTCCCTCGGCTCTGTTTAGACGAAACTGGTCCCACCACTTAGCAGCAGGACCATGCAACTGATGTGAAGC[A/G]
AAGGAAACCTTCTCCTGCTCAGTGCACTGAATCAAATCTAACTTCTTTTCCACAGCATGCAGCCAATCACCTGCCTCTACTAGGTTAGTGGTGCTTGAGA

Reverse complement sequence

TCTCAAGCACCACTAACCTAGTAGAGGCAGGTGATTGGCTGCATGCTGTGGAAAAGAAGTTAGATTTGATTCAGTGCACTGAGCAGGAGAAGGTTTCCTT[T/C]
GCTTCACATCAGTTGCATGGTCCTGCTGCTAAGTGGTGGGACCAGTTTCGTCTAAACAGAGCCGAGGGACAGCCTATCACTTGGCGGGAGTTTGCTGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 33.10% 12.06% 4.32% NA
All Indica  2759 33.30% 48.40% 18.16% 0.11% NA
All Japonica  1512 84.30% 0.90% 1.79% 12.96% NA
Aus  269 21.20% 71.00% 7.81% 0.00% NA
Indica I  595 45.90% 41.50% 12.61% 0.00% NA
Indica II  465 36.60% 43.70% 19.78% 0.00% NA
Indica III  913 22.90% 55.80% 21.03% 0.33% NA
Indica Intermediate  786 34.10% 47.80% 18.07% 0.00% NA
Temperate Japonica  767 85.70% 0.80% 2.09% 11.47% NA
Tropical Japonica  504 93.10% 0.40% 0.99% 5.56% NA
Japonica Intermediate  241 61.80% 2.50% 2.49% 33.20% NA
VI/Aromatic  96 80.20% 8.30% 8.33% 3.12% NA
Intermediate  90 63.30% 20.00% 14.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714344926 A -> DEL N N silent_mutation Average:14.847; most accessible tissue: Callus, score: 44.1 N N N N
vg0714344926 A -> G LOC_Os07g25120.1 upstream_gene_variant ; 3645.0bp to feature; MODIFIER silent_mutation Average:14.847; most accessible tissue: Callus, score: 44.1 N N N N
vg0714344926 A -> G LOC_Os07g25110.1 intron_variant ; MODIFIER silent_mutation Average:14.847; most accessible tissue: Callus, score: 44.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714344926 1.55E-06 1.55E-06 mr1061 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 9.08E-06 7.81E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 1.40E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 6.63E-06 3.55E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 6.90E-06 3.37E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 1.81E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 8.39E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 6.27E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 7.88E-06 7.88E-06 mr1389 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 4.10E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 3.20E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 4.03E-08 1.30E-10 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 6.85E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 6.25E-06 2.86E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 2.77E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 8.46E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 1.13E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 2.54E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 1.53E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 3.34E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 8.91E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714344926 NA 2.06E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251