\
| Variant ID: vg0714252447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14252447 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 195. )
GGTGGTGCTTCTCCCTTCAATGCTGCTAGCTCTTTCTCCAAACGATCCAGCTTGTCTTCTAGCTTGCAGATCTTTCCCCGATTCTGGTCTTCACGATCTT[G/A]
AGCGGCTATCACGATCTCAGCGCGGGTTTCATCCATAGCCCATAGCATCTCAACCAAGTGCCTTGTGGTAGCATCATTCTCGATCCCAGCCGGTTCAAGG
CCTTGAACCGGCTGGGATCGAGAATGATGCTACCACAAGGCACTTGGTTGAGATGCTATGGGCTATGGATGAAACCCGCGCTGAGATCGTGATAGCCGCT[C/T]
AAGATCGTGAAGACCAGAATCGGGGAAAGATCTGCAAGCTAGAAGACAAGCTGGATCGTTTGGAGAAAGAGCTAGCAGCATTGAAGGGAGAAGCACCACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 0.60% | 1.31% | 3.13% | NA |
| All Indica | 2759 | 97.40% | 0.00% | 0.58% | 1.96% | NA |
| All Japonica | 1512 | 89.70% | 1.80% | 2.65% | 5.89% | NA |
| Aus | 269 | 97.40% | 0.40% | 1.86% | 0.37% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.34% | 1.34% | NA |
| Indica II | 465 | 98.50% | 0.00% | 0.22% | 1.29% | NA |
| Indica III | 913 | 95.50% | 0.10% | 0.77% | 3.61% | NA |
| Indica Intermediate | 786 | 98.30% | 0.00% | 0.76% | 0.89% | NA |
| Temperate Japonica | 767 | 88.50% | 0.00% | 0.39% | 11.08% | NA |
| Tropical Japonica | 504 | 92.30% | 2.80% | 4.56% | 0.40% | NA |
| Japonica Intermediate | 241 | 88.00% | 5.40% | 5.81% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714252447 | G -> DEL | LOC_Os07g25010.1 | N | frameshift_variant | Average:16.782; most accessible tissue: Callus, score: 26.067 | N | N | N | N |
| vg0714252447 | G -> A | LOC_Os07g25010.1 | N | stop_gained | Average:16.782; most accessible tissue: Callus, score: 26.067 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714252447 | 5.11E-07 | 4.50E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 2.92E-06 | 9.55E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 2.55E-06 | 1.81E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | NA | 8.15E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 4.19E-06 | 1.43E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 1.93E-06 | NA | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | NA | 6.99E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 2.67E-06 | 2.43E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 4.78E-07 | 1.71E-06 | mr1123_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 1.57E-06 | 5.12E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 2.56E-06 | 2.33E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | NA | 9.14E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252447 | 2.30E-08 | 3.53E-09 | mr1496_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |