\
| Variant ID: vg0714252091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14252091 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 213. )
ACATCCCACCAATGATGTAAACACATGCAGGACCCACACACACAACCAAACTTAAGCAAGCAAACTAACACAACGATCTAAGGCAATGACTTAGCACAAC[G/A]
GTCTAGGTCTTCCGGGCATCGGAGTTGATTGAAGGCTCGTTCGGCACGTCCCCATCATCTTGAGTTGGTCCCCACTCGATCTTGGAATGGGTGCGCTTGG
CCAAGCGCACCCATTCCAAGATCGAGTGGGGACCAACTCAAGATGATGGGGACGTGCCGAACGAGCCTTCAATCAACTCCGATGCCCGGAAGACCTAGAC[C/T]
GTTGTGCTAAGTCATTGCCTTAGATCGTTGTGTTAGTTTGCTTGCTTAAGTTTGGTTGTGTGTGTGGGTCCTGCATGTGTTTACATCATTGGTGGGATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 23.70% | 8.08% | 2.98% | NA |
| All Indica | 2759 | 53.30% | 34.80% | 10.62% | 1.30% | NA |
| All Japonica | 1512 | 78.90% | 9.30% | 4.89% | 6.88% | NA |
| Aus | 269 | 98.10% | 0.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 71.40% | 18.20% | 9.58% | 0.84% | NA |
| Indica II | 465 | 38.70% | 48.80% | 11.83% | 0.65% | NA |
| Indica III | 913 | 49.10% | 39.80% | 8.87% | 2.30% | NA |
| Indica Intermediate | 786 | 53.10% | 33.30% | 12.72% | 0.89% | NA |
| Temperate Japonica | 767 | 86.60% | 0.90% | 1.56% | 10.95% | NA |
| Tropical Japonica | 504 | 70.20% | 20.40% | 7.34% | 1.98% | NA |
| Japonica Intermediate | 241 | 72.60% | 12.90% | 10.37% | 4.15% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 15.60% | 11.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714252091 | G -> DEL | N | N | silent_mutation | Average:17.297; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0714252091 | G -> A | LOC_Os07g25010.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.297; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714252091 | NA | 5.99E-06 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | 1.75E-06 | 4.49E-09 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | 2.10E-07 | 8.70E-07 | mr1053 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | 1.26E-06 | 1.33E-06 | mr1147 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | NA | 1.24E-06 | mr1279 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | NA | 4.45E-11 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | NA | 7.97E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714252091 | NA | 2.30E-08 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |