| Variant ID: vg0714251798 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14251798 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGATTCATCAACTGTGTCTGTTGGGCCAGGACTTGAGCGAGCGTGGGATTCTCCGCATTGTTGTTATTGTTGTTGTTGTTGGGGCCATTCCCGTTGCTGC[G/A,C]
AGTGAGCACCATCTGACATAGACAGGAGCACAAGAAGAGAAACAGGGGAAAACTACTTAGGATAGGGAATTAAATTAATTAACTTAACTTTTATTGATCT
AGATCAATAAAAGTTAAGTTAATTAATTTAATTCCCTATCCTAAGTAGTTTTCCCCTGTTTCTCTTCTTGTGCTCCTGTCTATGTCAGATGGTGCTCACT[C/T,G]
GCAGCAACGGGAATGGCCCCAACAACAACAACAATAACAACAATGCGGAGAATCCCACGCTCGCTCAAGTCCTGGCCCAACAGACACAGTTGATGAATCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 0.20% | 2.88% | 19.95% | NA |
| All Indica | 2759 | 69.00% | 0.30% | 2.46% | 28.20% | NA |
| All Japonica | 1512 | 86.60% | 0.00% | 4.03% | 9.33% | NA |
| Aus | 269 | 95.20% | 0.00% | 0.37% | 4.46% | NA |
| Indica I | 595 | 79.00% | 0.00% | 2.18% | 18.82% | NA |
| Indica II | 465 | 68.20% | 0.00% | 2.58% | 29.25% | NA |
| Indica III | 913 | 57.40% | 1.00% | 2.19% | 39.43% | NA |
| Indica Intermediate | 786 | 75.40% | 0.00% | 2.93% | 21.63% | NA |
| Temperate Japonica | 767 | 87.20% | 0.00% | 1.56% | 11.21% | NA |
| Tropical Japonica | 504 | 86.70% | 0.00% | 5.16% | 8.13% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.00% | 9.54% | 5.81% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714251798 | G -> DEL | LOC_Os07g25010.1 | N | frameshift_variant | Average:14.121; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0714251798 | G -> A | LOC_Os07g25010.1 | missense_variant ; p.Arg229Cys; MODERATE | N | Average:14.121; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0714251798 | G -> C | LOC_Os07g25010.1 | missense_variant ; p.Arg229Gly; MODERATE | nonsynonymous_codon ; R229G | Average:14.121; most accessible tissue: Minghui63 panicle, score: 29.741 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714251798 | 5.78E-07 | 7.46E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | 9.41E-06 | 8.33E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | 7.19E-07 | NA | mr1147 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | NA | 6.36E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | NA | 4.81E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | NA | 2.67E-06 | mr1500 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | NA | 1.53E-07 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | NA | 1.40E-06 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714251798 | NA | 9.73E-06 | mr1963 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |