| Variant ID: vg0714249759 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14249759 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTGATGTTCTCGCAGCTTCTCTAATGCAAGACGAAGATGTTCTTCATGCTCTTCTTTAGTTTAGGAATATATGAGAATGTCATCAATAAAGACAACCAC[G/A]
AACTTATCCAGGTATTCCATGAACACCTTGTTCATCAAGTTCATGAAGAAAGCAGGGGCATTGGTAAGTCCAAAAGACATAACTGTACATTCAAATAGCC
GGCTATTTGAATGTACAGTTATGTCTTTTGGACTTACCAATGCCCCTGCTTTCTTCATGAACTTGATGAACAAGGTGTTCATGGAATACCTGGATAAGTT[C/T]
GTGGTTGTCTTTATTGATGACATTCTCATATATTCCTAAACTAAAGAAGAGCATGAAGAACATCTTCGTCTTGCATTAGAGAAGCTGCGAGAACATCAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 5.40% | 9.18% | 34.60% | NA |
| All Indica | 2759 | 42.30% | 2.00% | 11.60% | 44.15% | NA |
| All Japonica | 1512 | 69.80% | 9.20% | 4.63% | 16.34% | NA |
| Aus | 269 | 39.80% | 0.40% | 5.20% | 54.65% | NA |
| Indica I | 595 | 48.90% | 0.50% | 7.39% | 43.19% | NA |
| Indica II | 465 | 47.30% | 2.40% | 15.70% | 34.62% | NA |
| Indica III | 913 | 31.30% | 2.70% | 11.17% | 54.76% | NA |
| Indica Intermediate | 786 | 47.10% | 1.90% | 12.85% | 38.17% | NA |
| Temperate Japonica | 767 | 67.10% | 14.60% | 3.52% | 14.73% | NA |
| Tropical Japonica | 504 | 76.00% | 1.40% | 4.96% | 17.66% | NA |
| Japonica Intermediate | 241 | 65.60% | 8.30% | 7.47% | 18.67% | NA |
| VI/Aromatic | 96 | 14.60% | 56.20% | 21.88% | 7.29% | NA |
| Intermediate | 90 | 66.70% | 5.60% | 10.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714249759 | G -> DEL | N | N | silent_mutation | Average:6.279; most accessible tissue: Callus, score: 18.544 | N | N | N | N |
| vg0714249759 | G -> A | LOC_Os07g25000.1 | downstream_gene_variant ; 3905.0bp to feature; MODIFIER | silent_mutation | Average:6.279; most accessible tissue: Callus, score: 18.544 | N | N | N | N |
| vg0714249759 | G -> A | LOC_Os07g25010.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.279; most accessible tissue: Callus, score: 18.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714249759 | NA | 4.04E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714249759 | NA | 7.14E-10 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714249759 | 8.43E-06 | NA | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714249759 | NA | 9.91E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714249759 | 4.37E-06 | 5.33E-06 | mr1888_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |