\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714207090:

Variant ID: vg0714207090 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14207090
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGTCCAGGAATCAGCCGAGGTACACAAACTGACAATTTAATATACAAATCCATCATAATATTAACGTTACATACTTACAAAAGAAAAGAAAACAGTAG[C/G]
GAAATTAACGATCTAGCGATGGCTTCAGCTCCACTCCCACAGGCAGCTCAACTGGGGTATAAGCCAAACGTCTTCTCCTTCTGGATCCTTTTTCTTCAAC

Reverse complement sequence

GTTGAAGAAAAAGGATCCAGAAGGAGAAGACGTTTGGCTTATACCCCAGTTGAGCTGCCTGTGGGAGTGGAGCTGAAGCCATCGCTAGATCGTTAATTTC[G/C]
CTACTGTTTTCTTTTCTTTTGTAAGTATGTAACGTTAATATTATGATGGATTTGTATATTAAATTGTCAGTTTGTGTACCTCGGCTGATTCCTGGACGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 1.00% 13.58% 49.89% NA
All Indica  2759 23.70% 0.80% 16.31% 59.22% NA
All Japonica  1512 49.30% 1.60% 4.83% 44.25% NA
Aus  269 87.40% 0.00% 10.04% 2.60% NA
Indica I  595 47.20% 0.20% 5.38% 47.23% NA
Indica II  465 23.70% 0.60% 6.88% 68.82% NA
Indica III  913 3.10% 1.10% 28.92% 66.92% NA
Indica Intermediate  786 29.90% 0.90% 15.52% 53.69% NA
Temperate Japonica  767 69.60% 0.10% 1.30% 28.94% NA
Tropical Japonica  504 20.20% 4.20% 10.32% 65.28% NA
Japonica Intermediate  241 45.60% 0.80% 4.56% 48.96% NA
VI/Aromatic  96 10.40% 0.00% 81.25% 8.33% NA
Intermediate  90 38.90% 1.10% 15.56% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714207090 C -> DEL N N silent_mutation Average:15.48; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg0714207090 C -> G LOC_Os07g24960-LOC_Os07g24970 intergenic_region ; MODIFIER silent_mutation Average:15.48; most accessible tissue: Minghui63 root, score: 23.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714207090 NA 8.27E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 8.48E-11 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 6.53E-06 2.53E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 1.06E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 6.94E-06 3.20E-06 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 6.26E-06 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 3.80E-07 3.80E-07 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 4.30E-06 NA mr1155 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 2.37E-07 2.38E-07 mr1204 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.16E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 5.12E-06 mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 8.61E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.40E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.06E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 4.75E-07 4.76E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.51E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.94E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 1.13E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 8.04E-06 1.61E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 5.25E-06 5.25E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 8.76E-09 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.86E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 1.38E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714207090 NA 2.06E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251