\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714179494:

Variant ID: vg0714179494 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14179494
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATGGGACATAATTAAGATTGTCATGCCAAAAATTATTGCAAAACCTAGTAGGAAAGCAAAAGAGGCGGGGGGGGGGGAGGAAACATGATCAATTTCTC[G/A]
GCTACTATCACATTCCTCGTTTTCTCAGGTTTGGGAGACATATAGCCACACTAAAGGCAGTAAACCTGAGGAATGACAACCTTACTCACAAGGACAAATA

Reverse complement sequence

TATTTGTCCTTGTGAGTAAGGTTGTCATTCCTCAGGTTTACTGCCTTTAGTGTGGCTATATGTCTCCCAAACCTGAGAAAACGAGGAATGTGATAGTAGC[C/T]
GAGAAATTGATCATGTTTCCTCCCCCCCCCCCGCCTCTTTTGCTTTCCTACTAGGTTTTGCAATAATTTTTGGCATGACAATCTTAATTATGTCCCATAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 2.40% 3.20% 11.34% NA
All Indica  2759 88.60% 4.20% 1.12% 6.13% NA
All Japonica  1512 70.60% 0.00% 7.74% 21.63% NA
Aus  269 89.20% 0.00% 0.00% 10.78% NA
Indica I  595 75.60% 12.10% 3.03% 9.24% NA
Indica II  465 92.90% 1.10% 0.43% 5.59% NA
Indica III  913 98.70% 0.00% 0.00% 1.31% NA
Indica Intermediate  786 84.10% 4.80% 1.40% 9.67% NA
Temperate Japonica  767 80.40% 0.00% 3.52% 16.04% NA
Tropical Japonica  504 61.70% 0.00% 16.07% 22.22% NA
Japonica Intermediate  241 58.10% 0.00% 3.73% 38.17% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 88.90% 0.00% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714179494 G -> DEL N N silent_mutation Average:21.856; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg0714179494 G -> A LOC_Os07g24930.1 upstream_gene_variant ; 2735.0bp to feature; MODIFIER silent_mutation Average:21.856; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg0714179494 G -> A LOC_Os07g24930-LOC_Os07g24940 intergenic_region ; MODIFIER silent_mutation Average:21.856; most accessible tissue: Minghui63 root, score: 27.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714179494 NA 2.42E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 4.30E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.69E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 4.99E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 7.38E-07 7.24E-07 mr1245_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.38E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 9.89E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.83E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 5.01E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 2.52E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 6.16E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.15E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 2.72E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.83E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.65E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.24E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 4.70E-07 4.70E-07 mr1651_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 9.58E-06 9.58E-06 mr1652_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 3.16E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 8.51E-07 6.36E-07 mr1655_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 2.20E-06 2.88E-08 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 9.78E-08 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 5.05E-06 5.05E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 9.07E-10 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 5.26E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494 NA 1.01E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251