Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714179494:

Variant ID: vg0714179494 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14179494
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATGGGACATAATTAAGATTGTCATGCCAAAAATTATTGCAAAACCTAGTAGGAAAGCAAAAGAGGCGGGGGGGGGGGAGGAAACATGATCAATTTCTC[G/A]
GCTACTATCACATTCCTCGTTTTCTCAGGTTTGGGAGACATATAGCCACACTAAAGGCAGTAAACCTGAGGAATGACAACCTTACTCACAAGGACAAATA

Reverse complement sequence

TATTTGTCCTTGTGAGTAAGGTTGTCATTCCTCAGGTTTACTGCCTTTAGTGTGGCTATATGTCTCCCAAACCTGAGAAAACGAGGAATGTGATAGTAGC[C/T]
GAGAAATTGATCATGTTTCCTCCCCCCCCCCCGCCTCTTTTGCTTTCCTACTAGGTTTTGCAATAATTTTTGGCATGACAATCTTAATTATGTCCCATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	2.40%	3.20%	11.34%	NA
All Indica	2759	88.60%	4.20%	1.12%	6.13%	NA
All Japonica	1512	70.60%	0.00%	7.74%	21.63%	NA
Aus	269	89.20%	0.00%	0.00%	10.78%	NA
Indica I	595	75.60%	12.10%	3.03%	9.24%	NA
Indica II	465	92.90%	1.10%	0.43%	5.59%	NA
Indica III	913	98.70%	0.00%	0.00%	1.31%	NA
Indica Intermediate	786	84.10%	4.80%	1.40%	9.67%	NA
Temperate Japonica	767	80.40%	0.00%	3.52%	16.04%	NA
Tropical Japonica	504	61.70%	0.00%	16.07%	22.22%	NA
Japonica Intermediate	241	58.10%	0.00%	3.73%	38.17%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	88.90%	0.00%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714179494	G -> DEL	N	N	silent_mutation	Average:21.856; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg0714179494	G -> A	LOC_Os07g24930.1	upstream_gene_variant ; 2735.0bp to feature; MODIFIER	silent_mutation	Average:21.856; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg0714179494	G -> A	LOC_Os07g24930-LOC_Os07g24940	intergenic_region ; MODIFIER	silent_mutation	Average:21.856; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714179494	NA	2.42E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	4.30E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.69E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	4.99E-07	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	7.38E-07	7.24E-07	mr1245_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.38E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	9.89E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.83E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	5.01E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	2.52E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	6.16E-06	mr1445_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.15E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	2.72E-07	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.83E-06	mr1616_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.65E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.24E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	4.70E-07	4.70E-07	mr1651_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	9.58E-06	9.58E-06	mr1652_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	3.16E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	8.51E-07	6.36E-07	mr1655_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	2.20E-06	2.88E-08	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	9.78E-08	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	5.05E-06	5.05E-06	mr1697_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	9.07E-10	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	5.26E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714179494	NA	1.01E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251