RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0714148441:

Variant ID: vg0714148441 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14148441
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGGGTGTCTTCGTTTGATAGGAGGATGCTAGGGTCAACCGTCACCGTGAAAGGGGGTTGCCCATCAAACTGATCATAATCCTCGTCAGTCTTGTCCTC[A/G,T]
ACTCCGATGATTTTTCTTTTGCTAGGGAGAACCACGTGGCACTTCGGCTCATCAGGCCCTTTGCCCTTCTTTCCTTTGCTAGACATGTCCTTCACATAAA

Reverse complement sequence

TTTATGTGAAGGACATGTCTAGCAAAGGAAAGAAGGGCAAAGGGCCTGATGAGCCGAAGTGCCACGTGGTTCTCCCTAGCAAAAGAAAAATCATCGGAGT[T/C,A]
GAGGACAAGACTGACGAGGATTATGATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGGTTGACCCTAGCATCCTCCTATCAAACGAAGACACCCTTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.40%	8.40%	14.49%	31.55%	T: 0.08%
All Indica	2759	26.70%	11.70%	18.05%	43.42%	T: 0.11%
All Japonica	1512	83.30%	0.40%	1.52%	14.81%	NA
Aus	269	36.40%	20.40%	34.57%	8.55%	NA
Indica I	595	51.30%	2.90%	8.91%	36.97%	NA
Indica II	465	25.80%	9.70%	12.90%	51.61%	NA
Indica III	913	7.80%	18.70%	26.07%	47.21%	T: 0.22%
Indica Intermediate	786	30.70%	11.50%	18.70%	39.06%	T: 0.13%
Temperate Japonica	767	84.50%	0.30%	1.04%	14.21%	NA
Tropical Japonica	504	93.80%	0.20%	0.99%	4.96%	NA
Japonica Intermediate	241	57.30%	1.20%	4.15%	37.34%	NA
VI/Aromatic	96	9.40%	12.50%	58.33%	18.75%	T: 1.04%
Intermediate	90	48.90%	3.30%	16.67%	31.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714148441	A -> DEL	LOC_Os07g24880.1	N	frameshift_variant	Average:6.25; most accessible tissue: Callus, score: 15.854	N	N	N	N
vg0714148441	A -> G	LOC_Os07g24880.1	synonymous_variant ; p.Val378Val; LOW	synonymous_codon	Average:6.25; most accessible tissue: Callus, score: 15.854	N	N	N	N
vg0714148441	A -> G	LOC_Os07g24880.1	synonymous_variant ; p.Val378Val; LOW	nonsynonymous_codon ; V378I	Average:6.25; most accessible tissue: Callus, score: 15.854	benign	0.482	DELETERIOUS	0.00
vg0714148441	A -> T	LOC_Os07g24880.1	synonymous_variant ; p.Val378Val; LOW	synonymous_codon	Average:6.25; most accessible tissue: Callus, score: 15.854	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714148441	NA	1.07E-06	mr1063	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714148441	NA	3.82E-07	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714148441	NA	4.77E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714148441	NA	2.61E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0714148441:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact