\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714142387:

Variant ID: vg0714142387 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14142387
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGACTTGCCTTGCTAAGAGAGAACGGCCTTCCGAACCTTCGGCGACGACCGCGAACCATGCTTCGAGAACCTTCGGAACGACAGAAGCTACGCGAAGC[A/G]
CACAAGCAAAGCTAAACCCTATAAAGAAGCAATAACAATACATAAAAAGAAAGCACACGGTTCTTTAGGTTATAACAAACATTAGGAGACTTGAACCGGT

Reverse complement sequence

ACCGGTTCAAGTCTCCTAATGTTTGTTATAACCTAAAGAACCGTGTGCTTTCTTTTTATGTATTGTTATTGCTTCTTTATAGGGTTTAGCTTTGCTTGTG[T/C]
GCTTCGCGTAGCTTCTGTCGTTCCGAAGGTTCTCGAAGCATGGTTCGCGGTCGTCGCCGAAGGTTCGGAAGGCCGTTCTCTCTTAGCAAGGCAAGTCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 0.90% 6.12% 21.65% NA
All Indica  2759 64.90% 0.00% 6.71% 28.38% NA
All Japonica  1512 76.70% 2.80% 6.08% 14.42% NA
Aus  269 94.40% 0.00% 4.09% 1.49% NA
Indica I  595 56.60% 0.00% 13.28% 30.08% NA
Indica II  465 54.80% 0.00% 5.16% 40.00% NA
Indica III  913 72.30% 0.00% 3.18% 24.53% NA
Indica Intermediate  786 68.60% 0.00% 6.74% 24.68% NA
Temperate Japonica  767 75.10% 5.10% 8.74% 11.08% NA
Tropical Japonica  504 73.80% 0.20% 2.78% 23.21% NA
Japonica Intermediate  241 88.00% 0.80% 4.56% 6.64% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 80.00% 1.10% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714142387 A -> DEL N N silent_mutation Average:4.93; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0714142387 A -> G LOC_Os07g24870.1 upstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:4.93; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0714142387 A -> G LOC_Os07g24850-LOC_Os07g24870 intergenic_region ; MODIFIER silent_mutation Average:4.93; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714142387 NA 4.85E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 7.86E-06 7.86E-06 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 NA 4.78E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 NA 6.51E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 NA 1.61E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 NA 1.91E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 NA 4.05E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 4.61E-06 3.33E-06 mr1129_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714142387 NA 7.19E-07 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251