\
| Variant ID: vg0714142387 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14142387 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTGACTTGCCTTGCTAAGAGAGAACGGCCTTCCGAACCTTCGGCGACGACCGCGAACCATGCTTCGAGAACCTTCGGAACGACAGAAGCTACGCGAAGC[A/G]
CACAAGCAAAGCTAAACCCTATAAAGAAGCAATAACAATACATAAAAAGAAAGCACACGGTTCTTTAGGTTATAACAAACATTAGGAGACTTGAACCGGT
ACCGGTTCAAGTCTCCTAATGTTTGTTATAACCTAAAGAACCGTGTGCTTTCTTTTTATGTATTGTTATTGCTTCTTTATAGGGTTTAGCTTTGCTTGTG[T/C]
GCTTCGCGTAGCTTCTGTCGTTCCGAAGGTTCTCGAAGCATGGTTCGCGGTCGTCGCCGAAGGTTCGGAAGGCCGTTCTCTCTTAGCAAGGCAAGTCACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 0.90% | 6.12% | 21.65% | NA |
| All Indica | 2759 | 64.90% | 0.00% | 6.71% | 28.38% | NA |
| All Japonica | 1512 | 76.70% | 2.80% | 6.08% | 14.42% | NA |
| Aus | 269 | 94.40% | 0.00% | 4.09% | 1.49% | NA |
| Indica I | 595 | 56.60% | 0.00% | 13.28% | 30.08% | NA |
| Indica II | 465 | 54.80% | 0.00% | 5.16% | 40.00% | NA |
| Indica III | 913 | 72.30% | 0.00% | 3.18% | 24.53% | NA |
| Indica Intermediate | 786 | 68.60% | 0.00% | 6.74% | 24.68% | NA |
| Temperate Japonica | 767 | 75.10% | 5.10% | 8.74% | 11.08% | NA |
| Tropical Japonica | 504 | 73.80% | 0.20% | 2.78% | 23.21% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.80% | 4.56% | 6.64% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 80.00% | 1.10% | 1.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714142387 | A -> DEL | N | N | silent_mutation | Average:4.93; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | N | N | N | N |
| vg0714142387 | A -> G | LOC_Os07g24870.1 | upstream_gene_variant ; 979.0bp to feature; MODIFIER | silent_mutation | Average:4.93; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | N | N | N | N |
| vg0714142387 | A -> G | LOC_Os07g24850-LOC_Os07g24870 | intergenic_region ; MODIFIER | silent_mutation | Average:4.93; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714142387 | NA | 4.85E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | 7.86E-06 | 7.86E-06 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | NA | 4.78E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | NA | 6.51E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | NA | 1.61E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | NA | 1.91E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | NA | 4.05E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | 4.61E-06 | 3.33E-06 | mr1129_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142387 | NA | 7.19E-07 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |