\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714140419:

Variant ID: vg0714140419 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14140419
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATATATGTTATTACAAAACTCATAACAAGTTACTATGTTTTAGTAGTAACATTATCGTATAAGTATAGTAACACGTCACGTTACTGCAAAACATATAG[G/A]
ATGTTACTGCACTTTTGATAGTAACATCGTAGTGAAATTGTAGTAAACTAGAAATCGAAAAAAAAATATATGAGTTAAAAGTCTACATGCTAACCATATA

Reverse complement sequence

TATATGGTTAGCATGTAGACTTTTAACTCATATATTTTTTTTTCGATTTCTAGTTTACTACAATTTCACTACGATGTTACTATCAAAAGTGCAGTAACAT[C/T]
CTATATGTTTTGCAGTAACGTGACGTGTTACTATACTTATACGATAATGTTACTACTAAAACATAGTAACTTGTTATGAGTTTTGTAATAACATATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 7.80% 10.85% 2.96% NA
All Indica  2759 91.40% 2.80% 5.65% 0.07% NA
All Japonica  1512 61.30% 13.80% 15.74% 9.13% NA
Aus  269 38.30% 26.40% 35.32% 0.00% NA
Indica I  595 89.70% 2.20% 7.73% 0.34% NA
Indica II  465 95.10% 1.70% 3.23% 0.00% NA
Indica III  913 89.80% 4.50% 5.70% 0.00% NA
Indica Intermediate  786 92.50% 2.00% 5.47% 0.00% NA
Temperate Japonica  767 76.70% 0.50% 6.26% 16.56% NA
Tropical Japonica  504 40.90% 36.90% 21.43% 0.79% NA
Japonica Intermediate  241 55.20% 7.90% 34.02% 2.90% NA
VI/Aromatic  96 76.00% 5.20% 18.75% 0.00% NA
Intermediate  90 87.80% 5.60% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714140419 G -> DEL N N silent_mutation Average:16.283; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0714140419 G -> A LOC_Os07g24870.1 upstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:16.283; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0714140419 G -> A LOC_Os07g24850-LOC_Os07g24870 intergenic_region ; MODIFIER silent_mutation Average:16.283; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714140419 NA 6.67E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 4.33E-07 4.33E-07 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 2.18E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 2.35E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 3.80E-06 3.80E-06 mr1373_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 5.25E-06 5.25E-06 mr1374_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 2.98E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 4.03E-06 NA mr1633_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 9.35E-07 9.35E-07 mr1636_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 4.58E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 4.40E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 7.48E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 5.18E-06 5.18E-06 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 1.54E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 6.33E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 2.77E-06 1.11E-07 mr1759_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 6.60E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714140419 NA 5.41E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251