\
| Variant ID: vg0714075702 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14075702 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 88. )
TTAAGTATGGATTTATGTTCTTCGACAGCATTTGGAAGATTGGCTAACTTTTGCTTCTCCAGATCCAACTCAGCATTGCATTCTTCAAGTTGAGCTATTA[G/A]
ATCAATCTTGCGGGCTTCAAGCCGATCTATGTTCGATTGAATCGGACCAGCAGAGAGTTGATCAAGCTTGGCTTTCTCCTCATGCACAAGCTGCCGATTG
CAATCGGCAGCTTGTGCATGAGGAGAAAGCCAAGCTTGATCAACTCTCTGCTGGTCCGATTCAATCGAACATAGATCGGCTTGAAGCCCGCAAGATTGAT[C/T]
TAATAGCTCAACTTGAAGAATGCAATGCTGAGTTGGATCTGGAGAAGCAAAAGTTAGCCAATCTTCCAAATGCTGTCGAAGAACATAAATCCATACTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 25.70% | 8.93% | 10.81% | NA |
| All Indica | 2759 | 37.30% | 36.90% | 10.91% | 14.90% | NA |
| All Japonica | 1512 | 86.00% | 4.70% | 3.51% | 5.82% | NA |
| Aus | 269 | 42.80% | 38.30% | 18.96% | 0.00% | NA |
| Indica I | 595 | 48.40% | 27.90% | 11.26% | 12.44% | NA |
| Indica II | 465 | 28.00% | 33.10% | 10.11% | 28.82% | NA |
| Indica III | 913 | 33.00% | 47.00% | 8.87% | 11.17% | NA |
| Indica Intermediate | 786 | 39.30% | 34.40% | 13.49% | 12.85% | NA |
| Temperate Japonica | 767 | 88.70% | 2.50% | 3.78% | 5.08% | NA |
| Tropical Japonica | 504 | 92.70% | 2.60% | 1.19% | 3.57% | NA |
| Japonica Intermediate | 241 | 63.50% | 16.20% | 7.47% | 12.86% | NA |
| VI/Aromatic | 96 | 83.30% | 10.40% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 14.40% | 14.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714075702 | G -> DEL | LOC_Os07g24760.1 | N | frameshift_variant | Average:19.584; most accessible tissue: Callus, score: 40.125 | N | N | N | N |
| vg0714075702 | G -> A | LOC_Os07g24760.1 | synonymous_variant ; p.Leu173Leu; LOW | synonymous_codon | Average:19.584; most accessible tissue: Callus, score: 40.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714075702 | NA | 7.00E-06 | mr1177 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714075702 | NA | 7.93E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714075702 | NA | 4.38E-07 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714075702 | NA | 7.24E-06 | mr1563_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714075702 | NA | 8.73E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |